Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

qbcSi9 [mex-5p::GFP::his-58::3XmiR-228::tbb-2 3’UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

qbcSi10 [mex-5p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

qbcSi11 [elt-1p::GFP::his-58::3XmiR-228::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

otIs870 [mir-228p::3xNLS::TagRFP] Pan-glial expression of tagRFP reporter. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.

maIs188 [mir-228p::GFP + unc-119(+)]. Wild type.