Search Strains

Homozygous viable. Deletion of 370 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTGTGTGTATGTATGTAGATCAGTGTTCC; Right flanking sequence: CGGAAAGTCTAATCTATTGCTGCGATTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1240 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTTTTAGAAAAATCGATCAGCCACGAAAAA; Right flanking sequence: ACCACTGCCGTCTTCGTGAACCGCATCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 57 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCCTTCTGAAACATCGATTCAGTGGAG. Right flanking sequence: AGGTTTGCGCACACTAATTATCGATTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 569 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAAATCGACCAATTCCTCGAATGGGAATCT; Right flanking sequence: CGGATCCAAGAAGGATATGAGAGTCAAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 713 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCTGGAAAAATTTGTTTTTTCGTAGATA; Right flanking sequence: AGGTGATGCAGCAGACAGATGTCACACTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 284 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATGCGATTGCTGCTTCATTTGTTATTCG; Right flanking sequence: TGGAAGCCATGCCAAGGTGAGTGGAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 536 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTAGTTCTTTAAATGACTACTGTAGTGT; Right flanking sequence: TGGTAACTAATCTCAAATAGATTTTAAATT. See WormBase Variation gk3695 for details.

Homozygous viable. Deletion of 1047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATTTGGACAACGCTCTGTGCACAAATCA; Right flanking sequence: TGGCTTAACGAATGAAGATAATGGATTCAA. See WormBase Variation gk3700 for details.

Homozygous viable. Deletion of 956 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCATCTTCAGCTAGCAGCTTCTTCGGAGG. Right flanking sequence: CGGATGCATTCAATGACAAGCAGATTTACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 272 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTCAGACTCCGCCCATACGTGTGCTCTCCA; Right flanking sequence: AGGTTCAACTTTTTCGAAAAACGAACAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 855 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCCACATGGTGACCTAGGTTTACAGGTGGT; Right flanking sequence: AGGTATGCAACAACGCTCCATTGCTAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGAAAAATTAAAGGAAATTGAACAGTAAG. Right flanking sequence: TGGAGGTGCAAGAGCCAGAAGAAAAAGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 761 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAGGACCAATGGATCTACGAAGTAAGTTG. Right flanking sequence: CGGCGAAAAGACGCCATCGACAAAAATCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTTCTTCCGCGTTTTCTAACCACTTTCC. Right flanking sequence: AGGTCAACGAGAAGTTATTGTTCCACAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 264 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAATTGTAGAGTTAAAATCTACATTTCCA; Right flanking sequence: CAGAAGGGAAACCATAAATAACGATGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 404 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCGCGTTTCTGTTAGCTATATTCAATTC; Right flanking sequence: TGGTGGTGGACGTAGAAGGTTAGTATACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 978 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAACATCACCGACTCGCGTGCAAAATCCG; Right flanking sequence: GGTTCCAGCAATGCAGGCTGTTCTCAGTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 634 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATGATTATCTGGATCCACCGTTATTTTGGG; Right flanking sequence: AGGTGAGTCGGGTGGAACCTCGAACACGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 877 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACAACTGTAACTCTGAAACTATTGAAGC. Right flanking sequence: TGGACACGATCCAGACGCCCCGGGACGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 581 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGCTTAATCCAAGATCCGTGTTCCATCAGC. Right flanking sequence: AGGTGGTGGTGCAGGAGGACGAGGTCCTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 425 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTCCCTGTGGAATTTCGGAGTGTCGTTGGC; Right flanking sequence: TGGTGCTCTATTATCAAGCGACAAAAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles and splicing defect allele identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Deletion of 1764 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGCGCGAGGATGATTTGAAACTGGCGCCC. Right flanking sequence: TGGAAGAACAATTGCTGCTTCTGACATTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 886 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTACAGAAGTTTTAAGAAAACTGGGTCAAG; Right flanking sequence: AGGAGCAATTGGCTCAGCAGCATCACCAGC. See WormBase Variation gk3768 for details.

Homozygous viable. Deletion of 857 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGATCAGCCGTACTATTGATACTCTATG; Right flanking sequence: TGGACGATCATGTGATTCGTGTTGACAAAG. See WormBase Variation gk3769 for details.

Homozygous viable. Deletion of 273 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGATGAACGCTTACAGAGAAACGGATATC; Right flanking sequence: AAGAAATATGTGAAACAAGGACGAGTTTGT. See WormBase Variation gk3771 for details.

Homozygous viable. Deletion of 331 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATCATTTAGTATTCTATGAGTTGGTCCTC; Right flanking sequence: AGGATGTGGACAGATTGTGAAAACTACAAT. See WormBase Variation gk3778 for details.

Homozygous viable. Deletion of 2037 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTGGCTCGTGTGTGGCGACTGCGGCCA; Right flanking sequence: CGGACCGTCAACAGATCAAGTCACTTCGGA. See WormBase Variation gk3792 for details.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Recessive lethal. Nonsense allele identified by amplicon sequencing, balanced by inversion marked with dpy-10 and myo-2 GFP. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP gk3816 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain.

Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGTCACAATGTTATCCACAATGTTCACCA; Right flanking sequence: CAAAATATAGAAGGAGCATTTGAGTTGGGT. See WormBase Variation gk3798 for details.

Homozygous viable. Deletion of 861 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CATGCACAACCAATGGAAGACAATCTTTTT; Right flanking sequence: TGGTATTCCAACACCACGCTCCCCGCTTGG. See WormBase Variation gk3799 for details.

Homozygous viable. Deletion of 800 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATTAGTCAGTATTTTTACTTGCCAGACG. Right flanking sequence: CGGACAAAGTTTTCTTGCTCCGAGGAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACAGTGGAATGGTTACCCGGTAATACACCC; Right flanking sequence: AGGTACCACAACGGAGGTAAATTTGAAAAA. See WormBase Variation gk3802 for details.

[NOTE: Please see RG5004 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATGGCTCCACAACGCAGCAACAATAGCA; Right flanking sequence: AGGAGTCACTGTAGTCAAGTACGTGTATGT. See WormBase Variation gk3808 for details.

Homozygous viable. Deletion of 2622 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCATTGGGAACATCACTGATTTATCCCCG; Right flanking sequence: TCTCTCTTTATCCGTTTTCAACATTTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AATTTATCAGGCGCTTCTTGCGGCCACATT. Right flanking sequence: GGGTTAAACTCGGAAACTTGTTCACAACCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GCAAAATTTGAATAAAAATTGGCCGCGCTA; Right flanking sequence: TGGATGCAGTTGCTTTTTCAAGAGAAGTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Recessive lethal deletion balanced by nT1. Deletion of 1177 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGCGACTTGACGAATTTTATCAAGATTA; Right flanking sequence: ATACGATGTCCTCGTTGTCCGAGCAGAATC. See WormBase Variation gk3838 for details.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles and splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Splicing defects identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Splicing defect identified by amplicon sequencing.

Recessive lethal deletion balanced by nT1. Deletion of 506 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCAATAATTTTGGGAAAAAACTCAAATTC; Right flanking sequence: GGGTATGGCTTCTAAACTTGCTATAACTTC. See WormBase Variation gk3855 for details.