Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
HA759 C. elegans pqe-1(rt13) III; rtIs11 V. Show Description
rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC.
HC114 C. elegans ccIs4251 I; qtIs3 III; mIs11 IV; sid-1(qt9) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding and injection and endogenous hairpin expression.
HC271 C. elegans ccIs4251 I; qtIs3 sid-2(qt42) III; mIs11 IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding only.
HC75 C. elegans ccIs4251 I; sid-1(qt2) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Resistant to systemic RNAi, but sensitive to autonomous RNAi.
JH103 C. elegans axIs36 X. Show Description
axIs36 [pes-10::GFP + dpy-20(+)] X. Slightly dumpy.
KN53 C. elegans huIs7. Show Description
huIs7 [hsp-16.2p::Myc::bar-1(delta N) + mec-7p::GFP + dpy-20(+)]. Muv. Posterior migration of the QR descendants. Reference: de Groot et al. (2014) Science Signal. Ra26.
LE3580 C elegans ayIs9 II; lqIs220 X. Show Description
ayIs9 [egl-17p::GFP + dpy-20(+)]. Reference: Tamayo JV, et al. BMC Genomics. 2013 May 4;14:304. doi: 10.1186/1471-2164-14-304. PMID: 23642123. lqIs221 is a Pegl-17::mab-5::gfp transgene. ayIs9 is a Pegl-17::gfp transgene. AQR migration defects. AQR in the tail in the normal position of PQR.
LW1288 C. elegans arIs37 I; sma-6(jj1) II; cup-5(ar465) III. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Small body size and 6 coelomocytes. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes.
LW2367 C. elegans arIs37 I; sma-9(cc604) X. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Tian et al. (2010) Development 137(14):2375-84.
LW557 C. elegans arIs37 I; fozi-1(cc607) cup-5(ar465) III. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Missing M-derived coelomocytes and 1-3 body wall muscles. Cells transformed to sex myoblast-like fates. myo-3p::ssGFP is a secreted GFP that it taken up by coelomocytes.
LW614 C. elegans arIs37 I; sma-3(jj3) cup-5(ar465) III. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Small body size and 6 coelomocytes. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes.
LW697 C. elegans ccIs4810 X. Show Description
ccIs4810 [(pJKL380.4) lmn-1p::lmn-1::GFP::lmn-1 3'utr + (pMH86) dpy-20(+)] I. GFP-tagged LMN-1 is expressed in all somatic cells. Reference: Haithcock E, et al. (2005) PNAS 102:16690-5.
LW709 C. elegans jjIs709 I. Show Description
jjIs709 [(pDRNL1) + lmn-1p::GFP::lmn-1::unc-54 3'utr + (pMH86) dpy-20(+)] I. GFP-tagged LMN-1 is expressed in all somatic cells. Reference: Haithcock E, et al. (2005) PNAS 102:16690-5.
MT5788 C. elegans nIs2 IV. Show Description
nIs2 [lin-11::lacZ + lin-11(+)] IV. WT phenotype. Integrated on IV near dpy-20. Derived from MT5759.
MT5790 C. elegans lin-4(e912) II; nIs2 IV. Show Description
nIs2 [lin-11::lacZ + lin-11(+)] IV. Vul. Integrated on IV near dpy-20.
MT5797 C. elegans lin-11(n389) I; nIs2 IV; lin-18(e620) X. Show Description
nIs2 [lin-11::lacZ + lin-11(+)] IV. Integrated on IV near dpy-20.
MT5798 C. elegans lin-11(n389) I; lin-26(n156) II; nIs2 IV. Show Description
nIs2 [lin-11::lacZ + lin-11(+)] IV. Integrated on IV near dpy-20.
NH2447 C. elegans ayIs2 IV. Show Description
ayIs2 [egl-15p::GFP + dpy-20(+)] IV. GFP expression in vm1 sex muscles and other miscellaneous cells.
NL1148 C. elegans dpy-20(e1282) IV; pkIs689. Show Description
pkIs689 [gpa-1::GFP + dpy-20(+)]. Reporter construct includes 1.5 kb upstream and the first 8 exons of gpa-1 fused in frame with GFP. 4.3 kb HindIII - BglII fragment cloned in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
NL1236 C. elegans acy-1(pk393) III; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1575 C. elegans dpy-20(e1282) IV; pkIs575. Show Description
pkIs575 [gpc-1::GFP + dpy-20(+)]. Reporter construct includes 4.2 kbp of upstream sequences, and most of the gpc-1 coding region, fused in-frame to GFP. 5.0 kbp XbaI - ScaI fragment cloned into pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.
NL1602 C. elegans dpy-20(e1282) IV; pkIs582. Show Description
pkIs582 [gpa-5::GFP + dpy-20(+)]. Reporter construct includes 4.5 kb upstream and the first 5 exons of gpa-5 fused in frame with GFP. 4.5 kb PstI - BamHI fragment cloned in pPD95.79. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
NL1608 C. elegans dpy-20(e1282) IV; pkIs588. Show Description
pkIs588 [gpa-11::GFP + dpy-20(+)]. Reporter construct includes 3030 bp upstream of ATG to +98 in exon 1 fused in frame with GFP in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
NL2334 C. elegans dpy-20(e1282) IV; pkIs1273. Show Description
pkIs1273 [gpa-16::GFP + dpy-20(+)].
NL2336 C. elegans dpy-20(e1282) IV; pkIs1275. Show Description
pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.
NP1360 C. elegans arIs37 I; cup-14(cd31) II. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.
NP717 C.elegans arIs37 I; unc-119(ed3) III; cdls32. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. A diphtheria toxin A fragment DT-A (E148D) is expressed under a coelomocyte-specific promoter leading to the absence of coelomocytes. Worms are slightly uncoordinated, slightly dumpy and slow growing. References: Fares H & Greenwald I. Genetics. 2001 Sep;159(1):133-45. doi: 10.1093/genetics/159.1.133. PMID: 11560892. Schwartz MS, et al. PLoS One. 2010 Mar 5;5(3):e9564. doi: 10.1371/journal.pone.0009564. PMID: 20221439.
OH10221 C. elegans ccIs4251 I; otIs77 II; ruIs37 III; jcIs1 IV; vsIs33 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. ruIs37 [myo-2p::GFP + unc-119(+)] III. jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. vsIs33 [dop-3::RFP] V. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.
OH12930 C. elegans pha-1(e2123) III; evIs82b IV; otEx5966. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. otEx5966 [bnc-1p::mChOpti + pha-1(+)]. Maintain at 25C to select for presence of otEx5966 array. VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14044 C. elegans evIs82b IV; bnc-1(ot763) V. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14045 C. elegans evIs82b IV; bnc-1(ot721) V. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH16949 C. elegans otIs736; evIs111. Show Description
otIs736 [cat-4p::mCherry + rol-6(su1006)]. evIs111 [F25B3.3::GFP + dpy-20(+)]. Rollers. Pan-neural GFP expression. The two HSN neurons are marked with both GFP and mCherry. Can be used to isolate HSN by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
OH4120 C. elegans rhIs4 III; wrk-1(ok695) X. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4125 C. elegans evIs82b IV; wrk-1(ok695) X. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV.
OH4128 C. elegans juIs76 II; evIs82b IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. evIs82b [unc-129::GFP + dpy-20(+)] IV.
OH4132 C. elegans vab-1(dx31) II; rhIs4 III; wrk-1(ok695) X. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4136 C. elegans rhIs4 III; wrk-1(tm1099) X. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4770 C. elegans ttx-3(mg158) X; otIs24. Show Description
otIs24 [sre-1::GFP + dpy-20(+)].
PD3011 C. elegans cyd-1(cc600) II; cup-5(ar465) III; arIs39 X. Show Description
arIs39 [myo-3p::ssGFP + dpy-20(+)].
PD4285 C. elegans mls-1(cc569) III; ayIs2 IV. Show Description
ayIs2 [egl-15p::GFP + dpy-20(+)] IV. Adult midbody GFP pattern in 8 vm-1 type muscles (instead of 4 as in WT). mls-1(o) converts uterine to vulval muscles.
PD4443 C. elegans ccIs4443 IV. Show Description
ccIs4443 [arg-1::GFP + dpy-20(+) ]. GFP activity in diverse differentiated non-striated mesodermal lineages. Strain might contain dpy-20(e1282) in background.
PD4666 C. elegans ayIs6 X. Show Description
ayIs6 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.
PD4667 C. elegans ayIs7 IV. Show Description
ayIs7 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.
PD6249 C. elegans ccIs4251 I; tam-1(cc567) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Homozygotes have decreased expression of tandem array transgenes, decreased fertility, and high incidences of males at 25C. Maintain at 15C.
PJ1277 C. elegans ccIs4251 I; unc-51(e369) ccIs55 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. ccIs55 [unc-54::lacZ + sup-7(st5)] V. GFP expression in nuclei and mitochondria of muscle cells.
PS2037 C. elegans syIs12 II. Show Description
syIs12 [hsp::lin-3 + dpy-20(+)]. "low dose" overexpressor of the EGF repeat of lin-3 under control of the heat shock promoter. Wild type vulval differentiation when grown at 20C. Muv phenotype resulting from heat shock at L2 lethargis. Reference: Katz WS, et al. Cell. 1995 Jul 28;82(2):297-307. Do not distribute this strain; other labs should request it from the CGC.
PS2943 C. elegans hmg-1.2(sy549) unc-32(e189) III; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Unc. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.
PS3170 C. elegans dpy-17(e164) hmg-1.2(sy549) III; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Dpy. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.
PS3352 C. elegans syIs50. Show Description
syIs50 [cdh-3::GFP + dpy-20(+)]. Line is a slightly Dpy, but appears healthy. Reference: Pettitt J, et al. Development. 1996 Dec;122(12):4149-57. Do not distribute this strain; other labs should request it from the CGC.
SD1333 C. elegans ccIs4251 I; stIs10047. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10047 [unc-14p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).