More Fields
Strain Species Genotype
GR2198 C. elegans mgTi1 I; unc-119(ed3) III. Show Description
mgTi1 [rpl-28p::skn-1a::GFP::tbb-2 3'UTR + unc-119(+)] I. Expresses SKN-1A with C-terminal GFP tag. Reference: Lehrbach NL & Ruvkun G. Elife. 2016 Aug 16;5. pii: e17721
KR359 C. elegans dpy-5(e61) knl-2(h80) unc-13(e450) I; sDp2 (I;f). Show Description
Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h80 arrests as a late larva). Maintain by picking Unc-13 and checking for correct segregation of progeny.
MSB1041 C. elegans bus-17(br2) X; mirIs92. Show Description
mirIs92 [daf-16p::daf-16::GcNL::let-858 3'UTR + myo-2p::mCherry]. bus-17(br2) has defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. daf-16 translational reporter with green non-calcium sensitive nanolantern (GCNL). Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.
MSB1088 C. elegans unc-119(ed3) III; mirIs110 V. Show Description
mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. GFP expression in coelomycetes. Integration of the calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) into tdTomato in the oxTi553 insertion. Expression of TeNL transgene in AWA by the odr-7 promoter. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB1091 C. elegans mirSi16 II; unc-119(ed3) III; mirIs110 V; mirIs107. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. mirIs107 [gpa:14p::CRE + npr-9p::ChR-HRDC::YFP::SL2::jRGECO1a + rps-0p::hygroR]. Blue fluorescence in flp-18 expressing neurons. Green coelomycetes segregates with calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in AWA. ChR2-HRDC and jRGECO1a in AVA (instead of BFP) and ChR2-HRDC::YFP and jRGECO1a in AIB. HygroR. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB486 C. elegans mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirEx131. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB577 C. elegans bus-17(br2) X; mirEx123. Show Description
mirEx123 [myo-3p::TeNL::unc-54 3' UTR]. Maintain strain by picking animals with blue fluorescence. bus-17(br2) has mutant defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in muscles. Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.
MSB609 C. elegans mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirIs47. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs47 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Blue fluorescence in flp-18 expressing neurons. loxP sites before first (eat-4(mir12[loxP 5'UTR])) and after second exon (eat-4(mir17[loxP intron2])) of eat-4 gene. Lite. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB. Conditional eat-4 KO in ASH (NOT defective) and ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB861 C. elegans mirSi16 II; mirIs76; mirEx69. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs76 [sra-6p::ChRmine::wrmScarlet::let-858 3UTR + sra-6p::TeNL]. mirEx69 [gpa:14p::CRE + unc-122p::mCherry]. Mantain by picking animals with mCherry+ coelomycetes. Blue in flp-18 expressing neurons. Expression of ChRmine, wrmScarlet and calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ. Expression of ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
NL1787 C. elegans unc-13(e51) I. NL subclone of KR1787. Show Description
NL subclone of KR1787. NL received strain KR1787 from Ann Rose 11/93. High copy Tc1 strain. See WBG 14(4): 16-17.
NL4000 C. elegans sma-1(e30) V. NL subclone of CB4000. Show Description
NL subclone of CB4000. High Tc1 copy number strain. See WBG 14(4): 16-17.
NL7000 C. elegans NL subclone of RW7000 Bergerac BO. Show Description
NL subclone of strain RW7000. NL7000 seems to have diverged from RW7000 strains in other labs. Some polymorphisms are different; the two strains may actually be quite diverged. NL received RW7000 in 1988. See WBG 14(4): 16-17. Rec'd new stock 5/97 from NL.
OD1 C. elegans unc-119(ed3) III; ltIs1. Show Description
ltIs1[pIC22; pie-1 promoter::knl-3::GFP + unc-119(+)].
OD1663 C elegans ltSi597 I; unc-119(ed3) III. Show Description
ltSi597 [knl-1p::knl-1::mCherry::knl-1 3'UTR Cbr-unc-119(+)] I. mCherry labeled KNL-1. Reference: Hattersley et al., Dev Cell 2016 Sep 12;38(5):463-77. doi: 10.1016/j.devcel.2016.08.006. PMID: 27623381
OD31 C. elegans unc-119(ed3) III; ltIs22. Show Description
ltIs22[pPM3; pie-1::GFP-TEV-STag::KNL-2 + unc-119(+)].
OD334 C elegans ltSi1 II; unc-119(ed3) III. Show Description
ltSi1 [knl-1p::knl-1(re-encoded)::RFP + Cbr-unc-119(+)] II. KNL-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Espeut J, et al. Cell Rep. 2015 Jul 7;12(1):58-65. doi: 10.1016/j.celrep.2015.05.039. PMID: 26119738
OD3392 C elegans knl-1(lt75[knl-1::mCherry]) III. Show Description
mCherry tag inserted at N-terminus of endogenous knl-1 locus using by CRISPR/Cas9 engineering. Reference: Cheerambathur DK, et al. Dev Cell. 2019 Mar 25;48(6):864-872.e7. doi: 10.1016/j.devcel.2019.02.002. PMID: 30827898
OD987 C elegans ltSi264 II; unc-119(ed3) III. Show Description
ltSi264 [bub-1p::bub-1(re-encoded)::RFP + Cbr-unc-119(+)] II. BUB-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Pelisch F, et al. Mol Cell. 2017 Jan 5;65(1):66-77. doi: 10.1016/j.molcel.2016.11.001. PMID: 27939944
PS9380 C. elegans kcnl-2(sy1754) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. left flanking sequence: GTGATGTAAACGAAATTCCAAAAACGAATGGAGG right flanking sequence: AGGACATCCAATTGTTAGAAGAAAAAGTGGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAAAAACGAATGGAGGTCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9381 C. elegans kcnl-2(sy1755) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: GAATGGAGCAATTGGAGATGATTCAACAGTTCCAT right flanking sequence: TGATGGACGAAAAAGATGATAACAGgttagttattc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATTCAACAGTTCCATTGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9672 C. elegans syIs300; syEx1718. Show Description
syEx1718 [kcnl-4p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + F58F6.6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Pick animals with RFP expression in coelomocytes to maintain. Split cGAL driver for PHC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. GFP cGAL effector.
PS9673 C. elegans syIs300; syEx1719. Show Description
syEx1719 [kcnl-4p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + Y48G10A.6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Pick animals with RFP expression in coelomocytes to maintain. Split cGAL driver for FLP and PVD neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. GFP cGAL effector.
TH243 C. elegans unc-119(ed3) III; ddIs153. Show Description
ddIs153 [knl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
VC2115 C. elegans knl-3(ok2788) V/nT1 [qIs51] (IV;V). Show Description
T10B5.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2788 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTTTTCGGCAAACTGCAAG. External right primer: AAAAATTGGAATCGGCTTGA. Internal left primer: GCCATTTCTTTGTTTTCAACG. Internal right primer: AAGCCCTGCTTGATTTCCTC. Internal WT amplicon: 1147 bp. Deletion size: 642 bp. Deletion left flank: AACGACACCACATTCTCGGTCAGAGCCGCG. Deletion right flank: AAACTAAGCTCAAGTCAGCTATTGAAATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2138 C. elegans kcnl-2(ok2818) I. Show Description
F08A10.1. External left primer: TTTCACAACTACCGCCCTTC. External right primer: AAAAAGAAGCGAACGAACGA. Internal left primer: GATGATTGGATGGTTGCCTT. Internal right primer: CCGACGTGATGATTACGCTA. Internal WT amplicon: 1193 bp. Deletion size: 546 bp. Deletion left flank: CTTCCAATCGAGTTCATAGCTCCATTTATG. Deletion right flank: AATTTCATGCAAGACACTCAACTTACTAAG. Insertion Sequence: TTTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2787 C. elegans +/mT1 II; knl-1(ok3457)/mT1 [dpy-10(e128)] III. Show Description
C02F5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3457 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCGATGGAATTGGACAACA. External right primer: ATTGTAGGCCTGATGCAAGG. Internal left primer: AGGCCATAATGAAACATCGC. Internal right primer: GTGAAGGCGGCATCTAAAAT. Internal WT amplicon: 1188 bp. Deletion size: 602 bp. Deletion left flank: GAATGGGCAAACAATGGAAGCTCTGACAGA. Deletion right flank: CAGCTAAGAGGTCTCGATAAGATGGCTGTC. Insertion Sequence: GGAAATTCGAAAATGGCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
ZG601 C. elegans iaIs21. Show Description
iaIs21 [gcy-35p::GFP + unc-119(+)]. gcy-35::GFP is expressed in fifteen neurons, all of which also express ahr-1: AQR, PQR, URXR/L, ALNL/R, BDUL/R, SDQL/R, PLML/R, AVM, and two neurons in the tail tentatively identified as PLNL/R. gcy-35::GFP is only transiently expressed in PLML/R during the first larval stage.
ABR161 C. elegans hjIs37; ldrIs1. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
AC257 C. elegans ppk-3(n2668) X. Show Description
Growth retardation, enlarged vacuoles (late endosomes and lysosomes) in intestine, epidermis, coelomocytes and pharynx. 27% embryonic lethality and 8% post-embryonic lethality.
ADS1002 C. elegans aeaIs10. Show Description
aeaIs10 [rgef-1p::GCaMP6s::3xNLS + lin-15(+)]. Worms express GCaMP6s in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446
ADS707 C. elegans unc-13(s69) I; aeaIs8; hpIs728. Show Description
aeaIs8 [ift-20p::GCaMP6s::3xNLS + lin-15(+)]. hpIs728 [gpc-1p::wCherry + lin-15(+)]. Unc. Nuclear-localized GCaMP6s expressed in ciliated sensory neurons. Cytoplasmic wCherry expression in a subset of neurons. Derived by crossing EG9631 (unc-13) hermaphrodites with ZM10104 (aeaIs8; hpIs728) heterozygous males. Reference: Lin A, et al. bioRxiv 2022.05.27.493772; doi: https://doi.org/10.1101/2022.05.27.493772.
AFS205 C. elegans zen-4(cle5) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
AFS222 C. elegans zen-4(cle10) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
AGK587 C. elegans armEx227. Show Description
armEx227 [pak-1p::NLS::tagRFP + rol-6(su1006)]. Pick rollers to maintain. pak-1p::NLS::tagRFP is expressed primarily in the hypodermal tissue during the comma and 1.5-fold stages, and in the CAN cells at the 3-fold stage through adulthood. Expression can also be seen in additional neurons during the larval and adult stages. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AMH82 C. elegans ccIs4251 I; ddi-1(ok1468) IV. Show Description
ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. ddi-1 also known as vsm-1.
AML10 C. elegans otIs355; otIs45 V. Show Description
otIs355 [rab-3::NLS::tagRFP]. otIs45 [unc-119::GFP] V. Pan-neural expression with no injection marker. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
AML14 C. elegans wtfEx4. Show Description
wtfEx4 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Pick RFP+ to maintain array. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
AML175 C. elegans lite-1(ce314) X; wtfIs3. Show Description
wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. Worms expressing the calcium insensitive fluorescent proteins GFP and tagRFP in the nuclei of all neurons in a lite-1(ce314) background. Control strain for AML70. Reference: https://www.biorxiv.org/content/biorxiv/early/2018/10/17/445643.full.pdf
AML18 C. elegans wtfIs3. Show Description
wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. RFP and GFP expression in the nuclei of all neurons. AML18 acts as a control for the calcium imaging strain AML14. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
AML310 C. elegans wtfIs5; wtfEx258. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. wtfEx258 [rig-3p::tagBFP::unc-54 3'UTR]. Pick BFP+ animals to maintain transgene. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons for whole brain imaging. BFP expression from rig-3 promoter allows identification of AVAL/R neurons. Reference: Hallinen KM, et al. eLife. 2021 Jul 29;10:e66135. doi: 10.7554/eLife.66135.
AML318 C. elegans otIs669 V. Show Description
Derived by out-crossing parental strain OH15262 an additional six times to N2. Out-crossed strain AML318 seems healthier than parental strain when maintaining long-term under normal conditions (AML observed an increase in male and sterile progeny in parental strain in successive generations.) otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642.
AML32 C. elegans wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. Derived from AML14 by integration of wtfEx4. Reference: Nguyen JP, et al. PLoS Comput Biol. 2017 May 18;13(5):e1005517.
AML5 C. elegans otIs355 IV; lin-15B&lin-15A(n765) X; kyIs51. Show Description
otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. kyIs51 [odr-2b::GFP + lin-15(+)]. Pan-neuronal nuclear RFP expression. Cytoplasmic GFP expressed in the odr-2b neurons including AIZ, AIB, SIAV, AVG, RIV, ASG and IL2 neurons. Derived from parental strains QW1155 and CX3300. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
AML551 C. elegans gur-3(ok2245) X; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a gur-3(ok2245) mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919.
AML554 C. elegans lite-1(ce314) gur-3(ok2245) X; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a lite-1(ce314) gur-3(ok2245) double mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919.
AML70 C. elegans lite-1(ce314) X; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a lite-1(ce314) mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919.
ANR149 C. elegans rrf-1(pk1417) I; pkIs2386. Show Description
pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. YFP expression in the muscles. Derived by crossing parental strains NL5901 and MAH23 to produce a Parkinson's model with germline-only RNAi. unc-119 might still be present in the background, but likely lost during crossing. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark.
ANR153 C. elegans rde-1(ne300) V.; neIs9 X; pkIs2386. Show Description
pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. neIs9 [myo-3::HA::rde-1 + rol-6(su1006)] X. Rollers. YFP expression in the muscles. Derived by crossing parental strains NL5901 and WM118 to produce a Parkinson's model with muscle-only RNAi. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark.
AQ866 C. elegans ser-4(ok512) III. Show Description
Y22D7AR.13. Hyperactive 5HT induced egglaying. Homozygous. Outer Left Sequence: AATTATCGGATTTAGGGCCG. Outer Right Sequence: ATGGAACGGAGCATTATTCG. Inner Left Sequence: CAACACGCAACGAATGTACC. Inner Right Sequence: TGTGAAGTTTGGGAGGCTTT. Inner primer WT PCR product: 3126. Outcrossed 5 times by Stanley Shyn. URL: http://www.celeganskoconsortium.omrf.org.
ATU3301 C. elegans ccIs4251 I; aceIs1. Show Description
ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator mitochondrial LAR-GECO in all body wall muscles.