Search Strains

wgIs73 [ceh-14::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs74 [hlh-8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs748 [ceh-6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgEx75 [elt-3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs77 [unc-130::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs78 [fkh-6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs81 [eor-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs83 [zag-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs86 [peb-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs90 [nhr-6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs92 [sdc-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs99 [nhr-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. GFP expression in germline. Transgene rescues unc-119(ed3). Improved GPR-1 over-expression transgene appears to be stably expressed in the germline at a wide range of temperatures and does not require special handling. (unlike other GPR-1 overexpressing transgenes previously described in the literature). The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance. Neomycin resistant. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.

ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. hjSi20 [myo-2p::mCherry::unc-54 3'UTR] IV. GFP expression in germline. mCherry expression in pharynx. The ccTi1594 transgene rescues unc-119(ed3). High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted at 3' end of endogenous src-1 locus using CRISPR/Cas9 engineering. gRNA sequence: AGCACAATTTTTTAGGCACT

apIs320 [let-7::unc-119(+)] II. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.

apIs402 [let-7(delta alg-1-binding site)::unc-119(+)] II. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.

apIs404 [let-7(delta alg-1-binding site)::unc-119(+)] II. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.

apIs320 [let-7::unc-119(+)] II. PQ425 was created by crossing PQ320 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.

apIs404 [let-7(delta alg-1-binding site)::unc-119(+)] II. PQ426 was created by crossing PQ404 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.

syEx1136 [myo-2p::GFP + unc-119(+)]. unc-119 animal rescued with array that expresses GFP in the pharyngeal muscles. Pick non-Unc animals to maintain the array. Highly outcrossed version of unc-119(ed3) generated by the Sternberg lab. Pick Unc animals for heavily outcrossed unc-119(ed3) to use for out-crossing biolistic insertions, mosSCI insertions or miniMos insertions based on unc-119 selection. Reference: Frokjær-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8.

vhIs24 [vha-6p::GFP::rab-5 Q78L + Cbr-unc-119(+)].  Large endosomes in the intestinal cells.

vhIs12 [vha-6p::GFP::tbc-2 + Cbr-unc-119(+)] II.  vhIs12 is inserted to the left of tbc-2(m2241) in LG II. GFP::TBC-2 rescues the large endosome phenotype in the intestine of tbc-2(tm2241) animals. Outside the intestine, tbc-2(tm2241) animals have large yolk platelets in the oocytes and early embryos that are not rescued.

vhIs1 [vha-6p::mCherry::tbc-2 + Cbr-unc-119(+)].  mCherry::TBC-2 is expressed in the intestine.

vhIs6 [vha-6p::mCherry::tbc-2(R689K) + Cbr-unc-119(+)].  mCherry::TBC-2(R689K) is expressed in the intestine.

zjIs5 [gst-4p::tdTomato::unc-54 3'UTR + unc-119(+)] II. Single copy insertion into ttTi5605 II. Fluorescence is dim; culture on 2-3 mM acrylamide to increase brightness. Reference: Tang L, et al. G3 (Besthesda). 2015 Dec 28;6(3):551–558. doi: 10.1534/g3.115.023010 PMID: 26715089.

Nonsense allele of peel-1 carried in Utah isolate EG4348 crossed into N2 Bristol background. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115.

rdIs24 [F12E12.5::GFP + unc-119(+)]. Spontaneous integrant of UL1189. Expresses GFP in somatic gonad during L2-L3 stages. Reference: Large EE, Mathies LD. Dev Biol. 2010 Mar 1;339(1):51-64.

rdIs26 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

rdIs27 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

rdIs7 [hnd-1::rde-1 + unc-119(+)] I. Rescued for RNAi in the mesoderm and SGPs. Reference: Large EE and Mathies LD. G3 (Bethesda). 2014 Mar 20;4(3):471-83.

rdIs4 [ehn-3a::Venus + unc-119(+)] X. Expresses Venus (YFP) in Z1/Z4 beginning in embryogenesis and continuing through the L1 larval stage. Reference: Large EE and Mathies LD. G3 (Bethesda). 2014 Mar 20;4(3):471-83.

rrrIs1 [pie-1p::GFP::Histone H2B::cye-1 3'UTR + unc-119(+)]. Slightly Unc.

rrrIs2 contains [pie-1p::GFP::Histone H2B::cye-1 3'UTR (S1mt+deltaS2-3)+ unc-119(+)]. Slightly Unc.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.

hutSi2642 [hsp-90p::mCherry::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mCherry from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

hutSi2661 [hsp-90p::eGFPT::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mEGFP from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

atrIs1 [ftt-2p::ftt-2::mCherry + unc-119(+)]. Line is slightly sick and burrows. FTT-2::mCherry fusion protein rescues ftt-2(tm1486) deletion mutant. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284. PMID: 28648843

pwIs403 [pie-1p::mCherry::rab-5 + unc-119(+)]. mCherry::RAB-5 provides a marker of early endosomes in the germline and in early embryos. Superficially wild-type. For best expression maintain propagate at 25 degrees.

pwIs20 contains [pie-1p::GFP::rab-5 + unc-119(+)]. Superficially wild-type. Maintain at 20 degrees.

pwIs503 [vha-6p::mans::GFP + Cbr-unc-119(+)]. This strain expresses an intestine-specific GFP marker for the Golgi apparatus (a fragment of C. elegans alpha-mannosidase II (F58H1.1, first 82 aa including signal sequence/TM-anchor domain as in Rolls et al., 2002). This fusion protein is expressed under the control of the vha-6 promoter.

pwIs50 [lmp-1::GFP + Cbr-unc-119(+)].

pwIs69 [vha-6p::GFP::rab-11 + unc-119(+)]. Likely integrated into LG X (based on user observations).

pwIs72 [vha-6p::GFP::rab-5 + Cbr-unc-119(+)]. Likely integrated in LG II.

pwIs98 [YP170::tdimer2 + unc-119(+)]. Reference: Sato M et al. (2008) EMBO J. 27(8):1183-96.

pwIs116 [rme-2p::rme-2::GFP::rme-2 3'UTR + unc-119(+)]. Superficially wild-type. Maintain at 20-25C to reduce silencing of the array.

pwIs170 [vha6p::GFP::rab-7 + Cbr-unc-119(+)].

asIs4 [egg-2::GFP + unc-119(+)]. Oocyte membranes are green.

asIs3 [egg-1::GFP + unc-119(+)]. Oocyte membranes are green.

pwIs206 [vha6p::GFP::rab-10 + Cbr-unc-119(+)].