| CF3649 |
C. elegans |
muIs209. Show Description
muIs209 [myo-3p::kin-19::tagRFP + tph-1p::GFP]. KIN-19::tagRFP aggregates with age in body-wall muscles. Animals have reduced thrashing compared to controls. Generated in N2 background. References: Huang YC, et al. Elife. 2019 May 3;8. pii: e43059. doi: 10.7554/eLife.43059. David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
|
|
| CF4611 |
C. elegans |
muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CL2179 |
C. elegans |
smg-1(cc546) I; dvIs179. Show Description
dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL2331 |
C. elegans |
dvIs37. Show Description
dvIs37 [myo-3p::GFP::A-Beta (3-42) + rol-6(su1006)]. Maintain at 16C. Roller. Diffuse and aggregated GFP expression in body wall muscle. Low brood size. Sicker at higher temperatures (e.g. 25C). Reference: Link CD, et al. (2008) Neurobiology of Disease,32(3):420-5.
|
|
| CL2337 |
C. elegans |
smg-1(cc546) I; dvIs38. Show Description
dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL4176 |
C. elegans |
smg-1(cc546) I; dvIs27 X. Show Description
dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL6180 |
C. elegans |
smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CYA14 |
C. elegans |
rde-1(ne300) V; neIs9 X; ldrIs1. Show Description
neIs9 [myo-3p::HA::rde-1 + rol-6(su1006)] X. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. Rollers. RDE-1 activity is rescued in the body-wall muscle, making animals RNAi-deficient except for body-wall muscle cells. Derived by crossing parental strains WM118 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
|
|
| CYA5 |
C. elegans |
rexEx3. Show Description
rexEx3 [myo-3p::GFP::Halo + mec-7p::mRFP]. Pick GFP+ to maintain. Mosaic expression of green fluorescence (GFP) in body-wall muscle and red fluorescence (mRFP) in touch-receptor neurons.
|
|
| CYA8 |
C. elegans |
rexEx6. Show Description
rexEx6 [myo-3p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in body-wall muscle; punctate mCherry signals in some animals. P2A is the self-cleaving peptide sequence.
|
|
| CZ18020 |
C. elegans |
juSi94 II; rps-18(ok3353) IV; juEx5377. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5377 [myo-3p::GFP1-10 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. Muscle-specific expression of split GFP reporter allows visualization of ribosomes in muscle. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
|
|
| CZ22703 |
C. elegans |
juEx6916. Show Description
juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
|
|
| DLM10 |
C. elegans |
uwaSi5 II; unc-119(ed3) III. Show Description
uwaSi5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
|
|
| DLM21 |
C. elegans |
unc-119(ed3)III; uwaEx4. Show Description
uwaEx4 [ubc-18::GFP::HA + myo-3p::RFP + unc-119(+)]. Pick RFP+ animals to maintain. Translational GFP transgene rescues ubc-18(tm5426).
|
|
| DLM9 |
C. elegans |
ttTi5605 II; unc-119(ed3) III; uwaEx5. Show Description
uwaEx5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
|
|
| EEG107 |
C.elegans |
tph-1(mg280) II; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. When tph-1 mutants carrying mudIs1 are exposed to blue light, the worms continue to move rather than stopping like wild-type animals. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| EEG108 |
C. elegans |
mod-5(n822) I; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| EEG98 |
C. elegans |
mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| EG4887 |
C. elegans |
oxIs322 II; unc-119(ed3) III. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus.
|
|
| EG5027 |
C. elegans |
oxIs353 V. Show Description
oxIs353 contains [myo-3p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.
|
|
| EG7212 |
C. elegans |
oxTi330 III; gaIs283. Show Description
oxTi330 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7213 |
C. elegans |
oxTi331 I; gaIs283. Show Description
oxTi331 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7214 |
C. elegans |
oxTi333 X; gaIs283. Show Description
oxTi333 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7215 |
C. elegans |
oxTi334; gaIs283. Show Description
oxTi334 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7216 |
C. elegans |
oxTi335 X; gaIs283. Show Description
oxTi335 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG8072 |
C. elegans |
oxSi259 I; oxIs322 II; oxTi81 V. Show Description
oxSi259 [eft-3p::GFP + Cbr-unc-119(+)] I. Cytoplasmic, green fluorescence expressed broadly (most cells). Integration into ttTi4348 mosSCI site (I:-5.32). oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Combined fluorescent balancer strain for LG I, LG II and LG V.
|
|
| EG8073 |
C. elegans |
oxIs322 II; oxSi199 IV; oxTi81 him-5(e1490) V. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG II, LG IV and LG V. Strain contains him-5(e1490) to generate males for crosses.
|
|
| EG8397 |
C. elegans |
oxIs322 II; oxTi80 III; him-5(e1490) V. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. Him. Combined fluorescent balancer strain for LG II and LG III. Strain contains him-5(e1490) to generate males for crosses.
|
|
| EG8398 |
C. elegans |
oxIs322 II; oxTi80 III; oxSi199 IV; him-5(e1490) V. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG II, LG III and LG IV. Strain contains him-5(e1490) to generate males for crosses.
|
|
| EG8760 |
C. elegans |
oxIs322 II; oxTi79 III; him-5(e1490) V. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi79 [eft-3p::GFP::H2B::tbb-2 3' UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: -26.22. Him. Combined fluorescent balancer strain for LG II and LG III. Strain contains him-5(e1490) to generate males for crosses.
|
|
| EG8776 |
C. elegans |
oxSi255 I; oxIs322 II; oxSi199 IV; him-5(e1490) V. Show Description
oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG I, LG II and LG IV. Strain contains him-5(e1490) to generate males for crosses.
|
|
| EG8841 |
C. elegans |
oxTi886 II; unc-119(ed3) III. Show Description
oxTi886 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-14.32). Insertion into T08E11.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
|
|
| EG8842 |
C. elegans |
oxTi887 II; unc-119(ed3) III. Show Description
oxTi887 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:2.59). Insertion into T08E11.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
|
|
| EG8843 |
C. elegans |
unc-119(ed3) III; oxTi888 V. Show Description
oxTi888 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. Pick GFP+ non-Unc to maintain. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:3.88). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
|
|
| EG8844 |
C. elegans |
unc-119(ed3) III; oxTi889 V. Show Description
oxTi889 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.44). Insertion into F25G6.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
|
|
| EL488 |
C. elegans |
ekl-1(om83)/unc-15 ccIs4251 I. Show Description
Heterozygotes are superficially wildtype and express GFP in body wall muscle nuclei. They segregate sterile ekl-1(om83) homozygotes and unc-15(e73) ccIs4251 homozygotes that are severely uncoordinated and GFP+ in body wall muscle nuclei. Pick wild-type GFP+ and check for correct segregation of progeny. The ccIs4251 insertion carries [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)]. Reference: She X, et al. PLoS Genet. 2009 Aug;5(8):e1000624. doi: 10.1371/journal.pgen.1000624. PMID: 19714217.
|
|
| ESC360 |
C. elegans |
rpoa-2(cse319[AID*::GFP::rpoa-2]) I; emcSi71 IV. Show Description
emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in muscles. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| GB296 |
C. elegans |
sfIs21. Show Description
sfIs21 [myo-3p::PercevalHR + lin-44p::GFP]. Reporter can be used to measure the ATP/ADP ratio in body wall muscle cells. Matsunaga Y, et al. Commun Biol. 2024 Oct 17;7(1):1342. doi: 10.1038/s42003-024-07042-3. PMID: 39420071.
|
|
| GR3149 |
C elegans |
mgIs72 II; mgIs78 IV. Show Description
mgIs72 [rpt-3p::GFP + dpy-5(+)] II. mgIs78 [myo-3p::H2B::mCherry::SL2::pbs-5(T65A)] IV. Muscle-specific proteasome dysfunction. Reference: Lehrbach NJ & Ruvkun G. Elife. 2019 Apr 11;8. pii: e44425. doi: 10.7554/eLife.44425.
|
|
| GW1485 |
C. elegans |
bqSi447 II; bqSi495 IV; ygIs2. Show Description
bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP_D5 + unc-119(+)] IV. ygIs2 [baf-1::GFP::lmn-1(Y59C) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1 (Y59C mutation). Might still carry unc-119(ed3) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.
|
|
| GW215 |
C. elegans |
hpl-2(tm1489) III; gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
|
|
| GW566 |
C. elegans |
gwIs39 III; gwIs4 X. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs4 [baf-1p::GFP-lacI::let-858 3UTR + myo-3p::RFP] X. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621
|
|
| GW637 |
C. elegans |
met-2(n4256) set-25(n5021) III; gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621
|
|
| GW76 |
C. elegans |
gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. [NOTE: transgene seems prone to silencing. Pick RFP+ to maintain.] Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364
|
|
| GW829 |
C. elegans |
gwIs39 III; cec-4(ok3124) IV; gwIs4 X. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs4 [baf-1p::GFP-lacI::let-858 3UTR + myo-3p::RFP] X. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. PMID: 26607792
|
|
| GW833 |
C. elegans |
cec-4(ok3124) IV; gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
|
|
| GW996 |
C. elegans |
gwSi17 set-4(n4600) II; met-2(n4256) set-25(n5021) III; gwIs4 X. Show Description
gwSi17 [cec?4p::cec?4::WmCherry::cec?4 3'UTR] II. gwIs4 [baf-1p::GFP-lacI::let-858 3UTR + myo-3p::RFP] X. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage). CEC-4::WmCherry is visible at the nuclear periphery in embryos and L1 stage animals. Reference: Cabianca DS, et al. Nature 2019 May;569(7758):734-739. PMID: 31118512
|
|
| HBR4 |
C. elegans |
goeIs3. Show Description
goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc54 3'UTR + unc-119(+)]. Reporter expresses the calcium indicator GCaMP3 in all body wall muscles. Reference: Schwarz J, et al. Worm. 2012 Jan 1;1(1):12-4.
|
|
| HC114 |
C. elegans |
ccIs4251 I; qtIs3 III; mIs11 IV; sid-1(qt9) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding and injection and endogenous hairpin expression.
|
|
| HC271 |
C. elegans |
ccIs4251 I; qtIs3 sid-2(qt42) III; mIs11 IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding only.
|
|