| AML318 |
C. elegans |
otIs669 V. Show Description
Derived by out-crossing parental strain OH15262 an additional six times to N2. Out-crossed strain AML318 seems healthier than parental strain when maintaining long-term under normal conditions (AML observed an increase in male and sterile progeny in parental strain in successive generations.) otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642.
|
|
| BW1809 |
C. elegans |
gpa-16(it143) I; him-5(e1490) V. Show Description
Temperature-sensitve. Maintain at 15C. Slight Maternal Effect Lethal (Mel) at 15C, more pronounced at 20C. Highly penetrant Mel at 25C and a fraction of the survivors have reversed left-right organs.
|
|
| CYA15 |
C. elegans |
rexEx7. Show Description
rexEx7 [gpa-4p::gfp::halo + mec-7p::mRFP]. Pick fluorescent worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Green fluorescence in two ASI neurons.
|
|
| DA2202 |
C. elegans |
daf-7(e1372) III; adEx2202. Show Description
adEx2202 [gpa-4p::daf-7 + rol-6p::GFP]. Rescues Daf-c. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.
|
|
| DR1349 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141 and 11(5) 60. Caenorhabditis elegans wild isolate. DR subclone of PA-1. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| DR1350 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. DR subclone of PA-2 (Tc1 pattern III). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| GJ20 |
C. elegans |
dpy-20(e1282) IV; pkIs1201. Show Description
pkIs1201 [gpa-3::GFP + dpy-20(+)].
|
|
| GJ443 |
C. elegans |
gjIs140. Show Description
gjIs140 [gpa-4::GFP + dpy-20(+)]. Reporter construct includes 2.5 kb upstream and the first exon of gpa-4 fused in frame with GFP. Reference: Burghoorn et al. Proc. Natl. Acad. Sci. USA 2007 Apr; 104(17):7157-62.
|
|
| GJ7 |
C. elegans |
gpa-2(pk16) gpa-3(pk35) gpa-13(pk1270) V; gpa-5(pk376) gpa-6(pk480) X. Show Description
Lans H, et al. Genetics. 2004 Aug;167(4):1677-87.
|
|
| GLW91 |
C. elegans |
hrpa-1(utx71[hrpa-1::mScarlet-I-C1::3xMyc]) IV. Show Description
C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd 5 GTCTCCACCAAACGCCTGTA 3 ; rev 5 CTAGCCTGTGTCCCATCAGC 3. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.
|
|
| GW1599 |
C. elegans |
met-2(n4256) set-25(n5021) III; opIs263. Show Description
opIs263 [rpa-1p::rpa-1::YFP + unc-119(+)]. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Express RPA-1::YFP in both germline and somatic tissues. Reference: Padeken J, et al. Genes Dev. 2019 Apr 1;33(7-8):436-451. PMID: 30804228
|
|
| HZ455 |
C. elegans |
him-5(e1490) V; bpIs131. Show Description
bpIs131 [sepa-1p::sepa-1::GFP + unc-76(+)]. Him. SEPA-1::GFP aggregates form in a temporal pattern. Diffuse SEPA-1::GFP is detectible in most cells at the comma stage and greatly diminished by the 2-fold stage. After hatching, cytoplasmic SEPA-1::GFP aggregates were found in a few unidentified cells in the head and tail regions and also in the intestine, especially in the anterior and posterior pairs of intestine cells. Reference: Tian Y, et al. Cell. 2010 Jun 11;141(6):1042-55.
|
|
| IG339 |
C. elegans |
tpa-1(fr1) frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
|
|
| IG341 |
C. elegans |
tpa-1(fr3) frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
|
|
| JDW656 |
C. elegans |
npa-1(wrd234[npa-1::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous npa-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JU4045 |
C. sp. 61 |
Caenorhabditis sp. 61 wild isolate. Show Description
Male-female species. Maintain at 20C or warmer. Elegans group. Isolated from rotting flower on upright Musa coccinea plant sampled near Sapa, Vietnam on 30 Nov 2019. GPS 22.33947, 103.86148. Reference: Felix et al., in preparation.
|
|
| JU4050 |
C. sp. 62 |
Caenorhabditis sp. 62 wild isolate. Show Description
Male-female species. Maintain at 20C or warmer. Elegans group. Isolated from rotting Solanum virginianum fruits sampled near Sapa, Vietnam on 30 Nov 2019. GPS 22.3228, 103.8841. Reference: Felix et al., in preparation.
|
|
| JU4056 |
C. sp. 63 |
Caenorhabditis sp. 63 wild isolate. Show Description
Male-female species. Maintain at 20C or warmer. Elegans group. Isolated from rotting fruit sampled near Sapa, Vietnam on 30 Nov 2019. GPS 22.32291, 103.88791. Reference: Felix et al., in preparation.
|
|
| JU4061 |
C. sp. 64 |
Caenorhabditis sp. 64 wild isolate. Show Description
Male-female species. Maintain at 20C or warmer. Portoensis group. Isolated from rotting Musa coccinea flower on ground, near Sapa, Vietnam on 1 Dec 2019. GPS 22.2898, 103.9337. Freeze with DMSO/Dextran protocol. Reference: Felix et al., in preparation.
|
|
| LG340 |
C. elegans |
skn-1(zu135) IV/nT1 [qIs51] (IV;V); geEx1. Show Description
geEx1 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Pick Rolling GFP+ and check for correct segregation of progeny to maintain. skn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Reference: Nature (2007) 447(7144):545-9.
|
|
| LG344 |
C. elegans |
geIs8. Show Description
geIs8 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.
|
|
| LG345 |
C. elegans |
geIs9. Show Description
geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.
|
|
| LG348 |
C. elegans |
skn-1(zu135) IV/nT1 [qIs51] (IV;V); geIs9. Show Description
geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.
|
|
| MJ500 |
C. elegans |
tpa-1(k501) IV. Show Description
Resistant to tetradecanoyl phorbol acetate. Semi-dominant.
|
|
| MJ563 |
C. elegans |
tpa-1(k530) IV. Show Description
Animals grow to be adults with smaller than normal body size and produce a reduced number of progeny on TPA-containing medium. No other apparent phenotypes were so far observed on NGM. Tc1 was originally inserted into a 2.4 kb HindIII genomic fragment. The 1.8 kb portion adjacent to the 3' end of the inserted Tc1 was replaced by an unidentified 1.0 kb fragment probably due to rearrangement during backcrossing.
|
|
| MOS370 |
C. elegans |
him-5(e1490) V; lite-1(ce314) X; fsIs22; ljIs114. Show Description
fsIs22 [osm-5p::fem-3::mCherry + unc-122p::GFP]. ljIs114 [gpa-13p?FLPase + sra-6p?FRT::mCherry::StopCodon::FRT?ChR2?YFP]. Him. Pan-ciliated masculinization with ChR2 specifically in ASH. Reference: Pechuk V., et al. 2022, Current Biology 32, 114. https://doi.org/10.1016/j.cub.2022.08.038
|
|
| MOS88 |
C. elegans |
him-5(e1490) V; etyIs1. Show Description
etyIs1 [gpa-13p::FLPase + sra-6p::FRT::mCherry::StopCodon::FRT::GCaMP6s]. Him. Integrated ASH-specific calcium sensor transgene. Reference: Pechuk V., et al. 2022, Current Biology 32, 114. https://doi.org/10.1016/j.cub.2022.08.038
|
|
| MSB1091 |
C. elegans |
mirSi16 II; unc-119(ed3) III; mirIs110 V; mirIs107. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. mirIs107 [gpa:14p::CRE + npr-9p::ChR-HRDC::YFP::SL2::jRGECO1a + rps-0p::hygroR]. Blue fluorescence in flp-18 expressing neurons. Green coelomycetes segregates with calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in AWA. ChR2-HRDC and jRGECO1a in AVA (instead of BFP) and ChR2-HRDC::YFP and jRGECO1a in AIB. HygroR. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB486 |
C. elegans |
mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirEx131. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB609 |
C. elegans |
mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirIs47. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs47 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Blue fluorescence in flp-18 expressing neurons. loxP sites before first (eat-4(mir12[loxP 5'UTR])) and after second exon (eat-4(mir17[loxP intron2])) of eat-4 gene. Lite. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB. Conditional eat-4 KO in ASH (NOT defective) and ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB861 |
C. elegans |
mirSi16 II; mirIs76; mirEx69. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs76 [sra-6p::ChRmine::wrmScarlet::let-858 3UTR + sra-6p::TeNL]. mirEx69 [gpa:14p::CRE + unc-122p::mCherry]. Mantain by picking animals with mCherry+ coelomycetes. Blue in flp-18 expressing neurons. Expression of ChRmine, wrmScarlet and calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ. Expression of ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MT23338 |
C. elegans |
nIs686 III; lin-15B&lin-15A(n765) X. Show Description
nIs686 [gpa-16p::GCaMP3::unc-54 3' UTR + lin-15(+)] III. Expression of GCaMP in RIP, pharyngeal muscle (pm2, pm3, and dimly/occasionally in pm1), mc1 marginal cells, and other unidentified cells. Derived by gamma-irradiation of nEx2309 in parental strain MT23222 and out-crossed five times to MT8189 lin-15B&lin-15A(n765). Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341
|
|
| NL1136 |
C. elegans |
mut-2(r459) I; gpa-5(pk375) X. Show Description
|
|
| NL1137 |
C. elegans |
gpa-5(pk376) X. Show Description
|
|
| NL1140 |
C. elegans |
dpy-20(e1282) IV; pkIs379. Show Description
pkIs379 [gpa-5XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1142 |
C. elegans |
gpa-8(pk345) V. Show Description
|
|
| NL1146 |
C. elegans |
gpa-6(pk480) X. Show Description
|
|
| NL1147 |
C. elegans |
gpa-10(pk362) V. Show Description
|
|
| NL1148 |
C. elegans |
dpy-20(e1282) IV; pkIs689. Show Description
pkIs689 [gpa-1::GFP + dpy-20(+)]. Reporter construct includes 1.5 kb upstream and the first 8 exons of gpa-1 fused in frame with GFP. 4.3 kb HindIII - BglII fragment cloned in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
| NL1533 |
C. elegans |
dpy-20(e1282) IV; pkIs533. Show Description
pkIs533[gpa-10XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
|
|
| NL1581 |
C. elegans |
dpy-20(e1282) IV; pkIs503. Show Description
pkIs503[gpa-1XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1584 |
C. elegans |
dpy-20(e1282) IV; pkIs515. Show Description
pkIs515 [gpa-4XS(+) + dpy-20(+)]. Not known to which LG the insertion is attached.
|
|
| NL1585 |
C. elegans |
dpy-20(e1282) IV; pkIs519. Show Description
pkIs519 [gpa-6XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
|
|
| NL1586 |
C. elegans |
dpy-20(e1282) IV; pkIs523. Show Description
pkIs523 [gpa-7(+) + dpy-20(+)].
|
|
| NL1587 |
C. elegans |
dpy-20(e1282) IV; pkIs527. Show Description
pkIs527 [gpa-8XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1588 |
C. elegans |
dpy-20(e1282) IV; pkIs531. Show Description
pkIs531[gpa-9XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
|
|
| NL1590 |
C. elegans |
dpy-20(e1282) IV; pkIs539. Show Description
pkIs539 [gpa-11(XS)(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1593 |
C. elegans |
dpy-20(e1282) IV; pkIs552. Show Description
pkIs552[gpa-14XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1594 |
C. elegans |
dpy-20(e1282) IV; pkIs555. Show Description
pkIs555 [gpa-15XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1602 |
C. elegans |
dpy-20(e1282) IV; pkIs582. Show Description
pkIs582 [gpa-5::GFP + dpy-20(+)]. Reporter construct includes 4.5 kb upstream and the first 5 exons of gpa-5 fused in frame with GFP. 4.5 kb PstI - BamHI fragment cloned in pPD95.79. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|