Search Strains

keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. N-terminal AID*::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]

keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of PALS-22 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]

keaSi11 [vit-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of vit-2p::TIR1::mRuby allows for auxin inducible degradation in the adult intestine. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]

keaSi9 [myo-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of myo-3p::TIR1::mRuby allows for auxin inducible degradation in the body wall muscles. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]

keaSi12 [dpy-7p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of dpy-7p::TIR1::mRuby allows for auxin inducible degradation in the epidermis. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]

kea15 [rgef-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of rgef-1p::TIR1::mRuby allows for auxin inducible degradation in neurons. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]

aaim-1 mutants are resistant to infection by N. parisii, but sensitive to infection by Pseudomonas aeruginosa PA14. No defects in development or lifespan were observed. Reference: Tamim El Jarkass H, et al. eLife. 2022;11:e72458. PMID: 34994689.

Impaired chemotaxis and foraging behavior. Excess intestinal fat accumulation. Reduced oxygen consumption. Derived from NL4000. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.

Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.

F49F1.6. mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9-engineered ?1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Derived by out-crossing parental strain PHX1027 (Suny Biotech) with N2 six times. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446

acEx185 [hsp-16.41p::par-5::VN173 + hsp-16.41p::his-1::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. BiFC reporter strain for PAR-5 and histone (H4) proteins interaction. To detect the protein-protein physical interactions, heat shock the animals for 3 hours at 33°C, allow them to recover for 12 hours at 20°C, and observe fluorescent-complementation signals under a high-magnification fluorescence microscope. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830.

acEx186 [hsp-16.41p::par-5::VN173 + hsp-16.41p::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. Control strain for AY185 strain. Heat shock induces protein expression but NO BiFC complementation. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830.

acEx190 [tax-2p::CZ::ced-3(p17)::unc-54 3’UTR + lim-6p::ced-3(p15)::NZ::unc-54 3’UTR + myo-3p::mCherry]. Pick mCherry+ to maintain.  ASG is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the tax-2 and lim-6 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721.

acEx191 [odr-2p::CZ::ced-3(p17)::unc-54 3’UTR+ unc-53p::ced-3(p15)::NZ::unc-54 3’UTR + rol-6(su1006)]. Pick Rollers to maintain.  PVP is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the odr-2 and unc-53 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721.

ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Homozygous expression of GFP::H2B histone fusion in germline. pAZ132.

ruIs37 [myo-2p::GFP + unc-119(+)] III. Expresses GFP in the pharynx. pAZ119.

ruIs38 [partial myo-2 promoter::GFP + unc-119(+)]. Expresses GFP in the pharynx. pAZ119.

ruIs48 [pie-1::tubulin::GFP + unc-119(+)]. Homozygous expression of GFP::tubulin fusion in germline and early embryos. Insertion unmapped. pAZ147.

ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Homozygous expression of GFP::tubulin fusion in germline and early embryos. Insertion unmapped. pAZ147.

Temperature sensitive. Fertile at 16C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature sensitive sterile. Paternal effect embryonic lethal. Permissive temp is 20C. Restrictive temp is 25C.

Temperature-sensitive. Maintain at 15C. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage. Increase lifespan in males and hermaphrodites.

Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage.

Heterozygotes are WT and segregate wild-type, wild-type heterozygotes, and Sterile Dpy (spe-4 dpy-20 homozygotes). Homozygous mutants are weak Dpy and partially fertile at 15C. Sterile at 20-25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature sensitive. Weak Dpy and partial fertility at 15C (very few progeny). Sterile at 20C and 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile and weak Dpy at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.

Unc. Leaky sterile at 20C; tighter at 16C and 25C. Easier to propagate as if male-female strain.

yanSi1 [eft-3p::dCAS9::VP64::tbb-2 3'UTR + Cbr-unc-119(+)] inserted into ttTi5605 (II:8.42 MB) in parental strain EG6699. Integration plasmid was generated via 3-way gateway reaction with pCFJ150 and plasmids containing eft-3 promoter (ID:1031@E02 promoterome), tbb-2 3'UTR (pCM1.36), and a full length dcas9::VP64 transgene cloned into pDONR201. Reference: Zullo JM, et al. Nature. 2019 Oct;574(7778):359-364. doi: 10.1038/s41586-019-1647-8. PMID: 31619788.

Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.

Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.

Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.

ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.

Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.

sEx10002[rCesC05D10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10004 [rCes C54H2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10008 [rCesF18E2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx841[rCesF43E2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx842 [rCesC34G6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx844 [rCesF22E10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx850 [rCesT21E8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx853 [rCes W09D6.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx855 [rCesC47A10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx857 [rCesDH11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx858 [rCesZK484.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx861 [rCes Y50E8A.16::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx862[rCesC54D1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).