Species Information: C. elegans

Name C. elegans
NCBI Taxonomy ID

C. elegans strains available at the CGC

Strain Genotype Description
PHX3251 flp-16(syb3251[flp-16::T2A::3XNLS::GFP]) II. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3262 nlp-47(syb3262[nlp-47::T2A::3XNLS::GFP]) IV. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3275 pdf-2(syb3275[pdf-2::T2A::3xNLS::GFP]) X. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. pdf-2 also known as nlp-37. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3288 nlp-23(syb3288[nlp-23::T2A::3xNLS::GFP]) X. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3320 nlp-49(syb3320[nlp-49::T2A::3XNLS::GFP]) X. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3334 flp-24(syb3334[flp-24::T2A::3×NLS::GFP]) III. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3372 rgba-1(syb3372[rgba-1::T2A::3xNLS::GFP]) I. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3373 nlp-70(syb3373[nlp-70::T2A::3xNLS::GFP]) V. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3384 nlp-64(syb3384[nlp-64::T2A::3xNLS::GFP]) X. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3388 nlp-38(syb3388[nlp-38::T2A::3xNLS::GFP]) I. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3436 flp-4(syb3436[flp-4::T2A::3XNLS::GFP]) II. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
VH7047 gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 2693 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTCTTTTTGAGAATTCGATTGAGAAGA; Right flanking sequence: GACATTTCGGCGGCAGTCAACATTAATGAA. sgRNA #1: ATAAAGTAGACATCTCGAGC; sgRNA #2: CTTGTCAATACTCTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7048 gst-3(hd7048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTAAAAGTTTATCGTTTTCAATATCCA; Right flanking sequence: TGGAGCAACTGGCCAGATGCACACTTATCT. sgRNA #1: GTTGATTAATGCCGAGTTGT; sgRNA #2: GCTCAGGAGACACAGACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7049 efl-2(hd7049[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 4502 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTGCTCGAGGGGCTCGGTTATGTGGAGA; Right flanking sequence: GGGCTTACCATTTTGTGGGCGTGGTTAGCT. sgRNA #1: GCTCGGTTATGTGGAGAAGG; sgRNA #2: CACAAAATGGTAAGCCCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7050 sknr-1(hd7050[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2851 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGAGACCCGGCAAAGAAACAAAGATTATC; Right flanking sequence: GCATGGCATTTCATCAAGAACAAAGAGATA. sgRNA #1: AAGAAACAAAGATTATCGTG; sgRNA #2: TTGATCGTGACTACATGGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7051 shw-1(hd7051[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 18084 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCATTACAGGCTCAAGGGAAAGAACCTCGG; Right flanking sequence: TGGAGGTTTTTGCTCCGAGCATGATCCGAG. sgRNA #1: TGAGTGAATTGAGTTGTCCG; sgRNA #2: CGACGTGTACTCATCTTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7053 ZK697.8(hd7053[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 946 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCATTGGTAAATTTAGAATTTCAAGGTATC; Right flanking sequence: TACTGGCCTAAAAGATAAAAAGTCTTGTTT. sgRNA #1: TAGAATTTCAAGGTATCGGC; sgRNA #2: TGCATATGATTTCCTAGTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7055 rfth-1(hd7055[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Heterozygous strain. Homozygous early larval arrest without immediately obvious morphological defects. Deletion of 4370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCGTCAGCTGCTCCTTCGTGTCGCCCCT; Right flanking sequence: CCTAAAACATCGTTATTGATCCTCCGCAAA. sgRNA #1: ATAGTATGGAGAGAGCCCTC; sgRNA #2: ATTAGTGAATGTGAGGTGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7056 cest-13(hd7056[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 4312 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAACATATGATGTGACAGTGCAAACACCA; Right flanking sequence: GCCTCAGTAGAGGTCCTCCGCCCCATCTTT. sgRNA #1: CGTATCGTTGCAGATCCATT; sgRNA #2: CATGTCACAACACGTAGGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7057 tmem-39(hd7057[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 1785 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGTCAATCCGACGACAATTGCAAGTTGAC; Right flanking sequence: CGGAAGGAGCTTGTGGTGGAGGTGCCGGCA. sgRNA #1: ATTCCCATACCTCGTTGATG; sgRNA #2: TCTTGGGATTGAAGCTGGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7058 ctf-18(hd7008[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7059 prk-1(hd7059[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 11634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTCCTGGGGCACCGCCTACTTTTGCCGCCG; Right flanking sequence: CGAAAGAAATCGAGTATTTTCAAATCATTT. sgRNA #1: ATTGCTGACGGTGGGCGCGG; sgRNA #2: CATCCGAACTAAATTATAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7060 asp-3(hd7060[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 2624 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGCATGATGAACTTGATGAGATAAACTG; Right flanking sequence: CGGAGGACAAAACTTCGATCTTCAAGGAAA. sgRNA #1: CTTGATGAGATAAACTGATG; sgRNA #2: AACATCACCTTCAACCTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
JK6099 lag-2(q1049[lag-2::3xV5]) V. 3xV5 tag inserted at C-terminus of endogenous lag-2 locus. Hermaphrodite DTC stain well. Animals are fertile and look wild-type. tracr + crRNA targeting the C-terminus of LAG-2 was injected with Cas-9 protein and repair template to insert a 3xV5 tag, following Fire and Seydoux lab RNP co-CRISPR strategy (with unc-58 crRNA and repair oligo to mark edited offspring).
JK6251 apx-1(q1148[apx-1::3xV5]) V. 3xV5 tag inserted at C-terminus of endogenous apx-1 locus. APX-1 guide: GACTCGTCATCTGCTGCCATCGG. APX-1 3xV5 repair with mutation (197 nt): CCTATGGCAGCAGATGACGAGTCGTCGTTTCGAGTCGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTAGATAGTACTGGAAAGCCAATCCCAAACCCACTCCTCGGACTTGATAGCACCGGTAAGCCTATCCCTAACCCACTCCTCGGACTTGATAGCACCTAAACAACAGCTCGACGACGAGATTTACAATAATT.
RG3377 F36D4.5(ve877[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCTTCGACTCACCATTCAGCGATCGAACC; Right flanking sequence: CCCATCACATCCATTGTGCTAGTGGGCGAG. F36D4.5 sgRNA A: AGAAGCAACTGAGAAACTAG F36D4.5 sgRNA B: AACAGCCAGAAGAAAAACTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3378 T08A11.1(ve878[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III:-3.39. Homozygous viable. Deletion of 3532 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGATTCTGATTATTCCACGAAGAACCT ; Right flanking sequence: CGGCCTCATCATAAACTCTCGAATTTCGAT. T08A11.1 sgRNA #1: CCTGCATTGGGTACCAACGG; T08A11.1 sgRNA #2: GGCGAGCACTGCCTGACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7052 ZK1058.3(hd7052[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 1531 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAACAATCAATCTTAAATCCGCTTGCTCC; Right flanking sequence: CGCCGGAGATTGCTGCAAAAACGCTGAGCG. sgRNA #1: TTAAATCCGCTTGCTCCCGG; sgRNA #2: AAAACAACGGGATCTTTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7054 R09H10.3(hd7054[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 695 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTAAGAAAACTCCGCACACAAACCTCATTT; Right flanking sequence: CCCTGGAACCTACCGATTGGTCTACATCAC. sgRNA #1: GCACACAAACCTCATTTCGA; sgRNA #2: CCCGATTTCACCCTAATCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7061 F10E9.4(hd7061[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III. Heterozygous strain, might not be homozygous viable. Deletion of 1418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAACGAGGATGGAACTACAGAAGTCCAGGA; Right flanking sequence: AGGATATTGATCTCAATAGCTCCAATTAAA. sgRNA #1: AACAGAAAGTGAAGCACCAA; sgRNA #2: ATTATGACTATGTACTTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7062 drl-1(hd7062[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Heterozygous strain, might not be homozygous viable. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTTTGAATTGAAAAGGGAGTGGTTTCCCT; Right flanking sequence: CGGCATTGAGTCTGGCGGCTGTTGCCGGTG. sgRNA #1: CCGATTCCGTTCCTAATCAC; sgRNA #2: GATTGGAATGGTGTTATGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7063 kin-14(hd7063[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 2852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATGGAAGTTTCGCCCAGCATTGTTTCAAA; Right flanking sequence: TGGCAGTTACAGTTAAGTTACAATATTTGG. sgRNA #1: GCGATTTCAGAAATGGTTGG; sgRNA #2: CAACGAAATTTGGCGCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7064 C08F8.6(hd7064[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 1370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCTCGAAAGTCAATCAATACAACTCCT; Right flanking sequence: AGGTCTCCTTTCGGGTTGGAACACTTGTAG. sgRNA #1: CCTTCTTATCGTCTTCATAC; sgRNA #2: CCTCGACTTTAAGTGCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7065 T23G7.2(hd7065[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1233 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCCAGTAATTCCAACACCCAAACTTCGCTC; Right flanking sequence: TGGGGCATAATACATAAAATAAATCGCTTG. sgRNA #1: ATTCCAATCATTTTCATGGG; sgRNA #2: AAACAAACCTGGAGAAATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7066 pph-1(hd7066[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTATTTTTTCGTTTTCAAAAAATAGTACCG; Right flanking sequence: CTGTCCCGGGTCCTTTCTTTTCTCCCGATT. sgRNA #1: CCTAGGTATTTTTGTTTTCT; sgRNA #2: CCCTTCAAACCATCACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7067 T25B9.2(hd7067[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 1673 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTCGGCAGGAGTTTGTTTTTTTTTCCT; Right flanking sequence: TGGTAAAAAATGTTCTACAATTTTTTACAT. sgRNA #1: ACATTATTCACAGTACTCAC; sgRNA #2: GTTAGAAATCATTACATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7068 Y51B9A.9(hd7068[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCAAATTCGGTCAGTGTACTGAAAATC; Right flanking sequence: CAATAATGCTGAGGAAAAAAGCTTCGAATA. sgRNA #1: TCATCCTTCATTTGTCTGGG; sgRNA #2: GAATTTTCAGGCAACACTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7070 hda-5(hd7070[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7071 hda-5(hd7071[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3373 F14H3.12(ve873[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:ATGAACTCCATTCAAATACAAGCGTGGTAG ; Right flanking sequence:CCTGATCAGCAGTCTCCAGCGCAAACCCAA. F14H3.12 sgRNA #1:TGTGCAGACCTGAAAGAACT ; F14H3.12 sgRNA #2:AAGATCAGGCGCGAGCAGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3371 R04B5.6(ve871[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1096 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATGTCTCAAGATAATTTGTCTGCTGTCCT ; Right flanking sequence: AGGAGTTGTTGTTCTAGTTGGATTGGGTGC. R04B5.6 sgRNA #1: GTAAATCGTTTATTCCGTAG; R04B5.6 sgRNA #2: TTGTAGACAACAAGATCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
PHX3112 nlp-12(syb3112[nlp-12::T2A::3×NLS::GFP]) I. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5413 flp-7(syb5413[flp-7::SL2::GFP::H2B]) X. Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7428 nlp-15(syb7428[nlp-15::SL2::GFP::H2B]) I. Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7537 nlp-20(syb7537[nlp-20::SL2::GFP::H2B]) IV. Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7352 nlp-29(syb7352[nlp-29::SL2::GFP::H2B]) V. Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7394 nlp-36(syb7394[nlp-36::SL2::GFP::H2B]) III. Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7422 nlp-39(syb7422[nlp-39::SL2::GFP::H2B]) I. Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7377 nlp-7b(syb7377[nlp-7b::SL2::GFP::H2B]) X. Endogenous nlp-7 locus (B-isoform) tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7564 nlp-79(syb7564[nlp-79::SL2::GFP::H2B]) IV. Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.