| NL1148 |
dpy-20(e1282) IV; pkIs689. |
pkIs689 [gpa-1::GFP + dpy-20(+)]. Reporter construct includes 1.5 kb upstream and the first 8 exons of gpa-1 fused in frame with GFP. 4.3 kb HindIII - BglII fragment cloned in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9. |
| GJ20 |
dpy-20(e1282) IV; pkIs1201. |
pkIs1201 [gpa-3::GFP + dpy-20(+)]. |
| GJ443 |
gjIs140. |
gjIs140 [gpa-4::GFP + dpy-20(+)]. Reporter construct includes 2.5 kb upstream and the first exon of gpa-4 fused in frame with GFP. Reference: Burghoorn et al. Proc. Natl. Acad. Sci. USA 2007 Apr; 104(17):7157-62. |
| NL1602 |
dpy-20(e1282) IV; pkIs582. |
pkIs582 [gpa-5::GFP + dpy-20(+)]. Reporter construct includes 4.5 kb upstream and the first 5 exons of gpa-5 fused in frame with GFP. 4.5 kb PstI - BamHI fragment cloned in pPD95.79. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9. |
| NL1608 |
dpy-20(e1282) IV; pkIs588. |
pkIs588 [gpa-11::GFP + dpy-20(+)]. Reporter construct includes 3030 bp upstream of ATG to +98 in exon 1 fused in frame with GFP in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9. |
| NL2334 |
dpy-20(e1282) IV; pkIs1273. |
pkIs1273 [gpa-16::GFP + dpy-20(+)]. |
| NL1575 |
dpy-20(e1282) IV; pkIs575. |
pkIs575 [gpc-1::GFP + dpy-20(+)]. Reporter construct includes 4.2 kbp of upstream sequences, and most of the gpc-1 coding region, fused in-frame to GFP. 5.0 kbp XbaI - ScaI fragment cloned into pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94. |
| NL2336 |
dpy-20(e1282) IV; pkIs1275. |
pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94. |
| JK1058 |
gld-1(q343)/unc-11(e47) dpy-5(e61) I |
Heterozygotes are WT and segregate WT, Dpy Uncs, and homozygous q343 (make small abnormal oocytes. Pick WT and check for correct segregation of progeny to maintain. Reference: Francis R, et al. Genetics. 1995 Feb; 139(2): 579–606. doi: 10.1093/genetics/139.2.579 PMID: 7713419. |
| JK4174 |
K10D2.2(q792) III. |
Superficially wild-type. K10D2.2 is a gld-2 paralog. |
| JK4177 |
pup-3(q793) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q793 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. |
| JK4220 |
puf-6(q759) II. |
Superficially wild-type. |
| JK4278 |
puf-12(q810) II. |
Superficially wild-type. |
| JK4619 |
tra-1(q106) III/eT1[qIs60](III;V). |
qIs60 [pes-10::GFP + gut specific promoter::GFP + myo-2::GFP]. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP males, and dead eggs (eT1 homozygotes). Pick wild-type GFP+ and check for proper segregation of progeny to maintain. Reference: Schedl T, et al. Genetics. 1989 Dec;123(4):755-69. doi: 10.1093/genetics/123.4.755. PMID: 2612895. |
| JK4930 |
lag-1(q426) IV/nT1[qIs51](IV; V). |
Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP q426 homozygotes (variable phenotypes including sterile, L1 lethal, and small sterile adults with rectal protrusion and occasional bent pharynx). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kadyk LC & Kimble J. Development. 1998 May;125(10):1803-13. doi: 10.1242/dev.125.10.1803. PMID: 9550713. |
| JK5020 |
glp-1(q172) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q172 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Crittenden SL, et al. Development. 1994 Oct;120(10):2901-11. doi: 10.1242/dev.120.10.2901. PMID: 7607080. |
| JK5250 |
pole-1(q831)/hIn1[unc-54(h1040)] I. |
Heterozygotes are fertile WT (non-Unc) and segregate fertile WT (q831/hIn1), fertile Unc (hIn1/hIn1), and sterile non-Uncs (q831/q831). Pick fertile WT and check for correct segregation of progeny to maintain. Reference: Robinson-Thiewes S, et al. G3 (Bethesda). 2022 Mar 4;12(3):jkab439. doi: 10.1093/g3journal/jkab439. PMID: 35100350. |
| JK5455 |
q833 V/nT1[qIs51](IV; V). |
hets are green pharynx WT and segregate green pharynx WT, fertile non-green pharynx and dead eggs (nT1 homozygotes). q833 is a 472 bp deletion into the intergenic region between mir-61/ mir-250 and F55A11.4. |
| JK5556 |
F17E5.2(q864) X. |
350 bp deletion in F17E5.2 |
| JK5596 |
lst-1(q867) I. |
CRIPSR-engineered mutation of the lst-1M71 longform start codon (ATG to AT, deletion of G). Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205 |
| JK5687 |
pgl-1(q894[pgl-1::SNAP]) IV. |
SNAP tag inserted into endogenous pgl-1 locus between G713 and G714. |
| JK5731 |
cya-1(q903[cya-1::3xMyc]) III. |
Internal 3xMyc tag inserted into endogenous cya-1 locus. |
| JK5736 |
cyb-2.1(q908[3xMyc::cyb-2.1]) IV. |
3xMyc tag inserted at N-terminus of endogenous cyb-2.1 locus. |
| JK5739 |
cyb-2.2(q911[3xMyc::cyb-2.2]) I. |
3xMyc tag inserted at N-terminus of endogenous cyb-2.2 locus. |
| JK5742 |
cyb-3(q914[cyb-3::3xMyc]) V. |
Internal 3xMyc tag inserted into endogenous cyb-3 locus. |
| JK5745 |
cyd-1(q917[cyd-1::3xMyc]) II. |
Internal 3xMyc tag inserted into endogenous cyd-1 locus. |
| JK5748 |
cye-1(q920[3xMyc::cye-1]) I. |
3xMyc tag inserted at N-terminus of endogenous cye-1 locus. |
| JK5751 |
cdk-1(q923[3xMyc::cdk-1]) III. |
3xMyc tag inserted at N-terminus of endogenous cdk-1 locus. |
| JK5758 |
lst-1(q895[lst-1(long)::3xFLAG]) I. |
3xFLAG tag inserted at the C terminus of the endogenous lst-1 locus, after V398 of the long isoform. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205 |
| JK5796 |
lst-1(q869) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. q869 is a deletion of the entire lst-1 coding sequence as well as 139 bp upstream of M71 start codon and 228 bp downstream of the coding sequence. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205 |
| APL31 |
lin-12(ljf31[lin-12::mNeonGreen[C1]::3xFLAG]) III. |
mNG and 3xFLAG tags fused to the C-terminal end of the intracellular domain of the endogenous lin-12 locus using a 9 amino acid flexible linker. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394. |
| DQM1070 |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. |
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394. |
| DQM1072 |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. |
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394. |
| DQM1051 |
lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. |
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
| DQM1066 |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. |
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
| DQM1068 |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. |
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
| ANR165 |
eif-2alpha(rog3) I. |
eif-2alpha(rog3) is a (S49A) substitution allele (I:2073439..2073448; WS220) removing P site and PAM site. eif-2alpha (Y37E3.10) encodes the alpha subunit of eukaryotic translation initiation factor 2 (eIF2). Reference: Rollins J, et al. Loss of eif-2alpha phosphorylation on S49 (mammalian S51) associated with the integrated stress response hastens development in C. elegans. MicroPubl Biol. 2017;2017:10.17912/W2BM1S. doi: 10.17912/W2BM1S. Erratum in: MicroPubl Biol. 2020 Feb 27;2020: PMID: 32292896. |
| OH13513 |
otIs597. |
otIs597 [ser-7p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M4 pharyngeal neuron. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH13517 |
otIs601. |
otIs601[ceh-19p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for MC pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH13518 |
otIs602. |
otIs602 [mnm-2p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M3 pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH15089 |
otIs657. |
otIs657 [klp-6p::mCherry + flp-3p::mCherry + klp-6p::NLG1::GFP1-10 + flp-3p::NLG1::GFP11]. IL2-IL1 GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH16263 |
otEx7457. |
otEx7457 [sri-9::mCherry + sri-9p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ADL>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH16265 |
otEx7459. |
otEx7459 [srh-18::mCherry + srh-18p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ASH>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH16738 |
otIs789. |
otIs789 [srg-8p::TagRFP + srg-8p::GFP::cla-1 + inx-6(prom18)::tagRFP]. ASKp::GFP::CLA-1(S) pre-synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH17225 |
otEx7760. |
otEx7760 [cat-4p::mCherry + zig-3p::mCherry + zig-3p::NLG1::GFP1-10 + cat-4p::NLG1::GFP11 + inx-6(prom18)::TagRFP]. BDU-HSN GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH17492 |
him-5(e1490) V; otEx7809. |
otEx7809 [flp-7p::TagRFP + inx-1::tagRFP + flp-7p::NLG1::GFP1-10 + inx-1p::NLG1::GFP11]. Him. AIB-SAA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| RG3374 |
F54D5.9(ve874[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1905 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTCCAGCTGCTCCTCTTCTTCTAGTGGAT ; Right flanking sequence: CGGTGGCTCGGTTCGCCGAAACATTTTTAT. F54D5.9 sgRNA #1: CATTGACGAGTTCAGCAGCT; F54D5.9 sgRNA #2: TTTCTAGCCAACAATCGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| AY189 |
unc-30(ok613) IV; acEx189. |
acEx189 [rab-3p::unc-30 + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by rab-3 neuronal promoter rescues unc-30(ok613) in neurons. Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721. |
| RG3380 |
C11E4.6(ve880[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Homozygous viable. Deletion of 5859 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATAAAGTTGCGTTGTTTCTCAGCTCGAAA ; Right flanking sequence: CGGCATAACAGTCAGCAAACTACTGAGAAC. sgRNA#1: AAGGGCAAAAAGATTCGAAG ; sgRNA #2:AAGGAACAATGGTACGATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3379 |
ugt-47(ve879[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 1932 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCTTCAGTCAGCAATTCATGAACTCCT ; Right flanking sequence: CAATCCTACCATTTGATATTAAATGTGATT. ugt-47 sgRNA #1: GAGTGGGTTATTCAGAATGG; ugt-47 sgRNA #2: CTGATGAATTGGCAAAAGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |