| DQM1072 |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. |
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394. |
| DQM1051 |
lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. |
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
| DQM1066 |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. |
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
| DQM1068 |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. |
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
| ANR165 |
eif-2alpha(rog3) I. |
eif-2alpha(rog3) is a (S49A) substitution allele (I:2073439..2073448; WS220) removing P site and PAM site. eif-2alpha (Y37E3.10) encodes the alpha subunit of eukaryotic translation initiation factor 2 (eIF2). Reference: Rollins J, et al. Loss of eif-2alpha phosphorylation on S49 (mammalian S51) associated with the integrated stress response hastens development in C. elegans. MicroPubl Biol. 2017;2017:10.17912/W2BM1S. doi: 10.17912/W2BM1S. Erratum in: MicroPubl Biol. 2020 Feb 27;2020: PMID: 32292896. |
| OH13513 |
otIs597. |
otIs597 [ser-7p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M4 pharyngeal neuron. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH13517 |
otIs601. |
otIs601[ceh-19p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for MC pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH13518 |
otIs602. |
otIs602 [mnm-2p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M3 pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH15089 |
otIs657. |
otIs657 [klp-6p::mCherry + flp-3p::mCherry + klp-6p::NLG1::GFP1-10 + flp-3p::NLG1::GFP11]. IL2-IL1 GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH16263 |
otEx7457. |
otEx7457 [sri-9::mCherry + sri-9p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ADL>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH16265 |
otEx7459. |
otEx7459 [srh-18::mCherry + srh-18p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ASH>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH16738 |
otIs789. |
otIs789 [srg-8p::TagRFP + srg-8p::GFP::cla-1 + inx-6(prom18)::tagRFP]. ASKp::GFP::CLA-1(S) pre-synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH17225 |
otEx7760. |
otEx7760 [cat-4p::mCherry + zig-3p::mCherry + zig-3p::NLG1::GFP1-10 + cat-4p::NLG1::GFP11 + inx-6(prom18)::TagRFP]. BDU-HSN GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH17492 |
him-5(e1490) V; otEx7809. |
otEx7809 [flp-7p::TagRFP + inx-1::tagRFP + flp-7p::NLG1::GFP1-10 + inx-1p::NLG1::GFP11]. Him. AIB-SAA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| RG3374 |
F54D5.9(ve874[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1905 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTCCAGCTGCTCCTCTTCTTCTAGTGGAT ; Right flanking sequence: CGGTGGCTCGGTTCGCCGAAACATTTTTAT. F54D5.9 sgRNA #1: CATTGACGAGTTCAGCAGCT; F54D5.9 sgRNA #2: TTTCTAGCCAACAATCGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| GT350 |
aSi26 II; unc-119(ed3) III. |
aSi26 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483. |
| GT372 |
aSi31 II; unc-119(ed3) III |
aSi31 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483. |
| GT330 |
aSi8 II; unc-119(ed3) III. |
aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483. |
| GT347 |
aSi23 II; unc-119(ed3) III. |
aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483. |
| GT375 |
aSi27 II; unc-119(ed3) III. |
aSi27 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7s::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7s in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483. |
| GT377 |
aSi36 II; unc-119(ed3) III. |
aSi36 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7f::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483. |
| AY189 |
unc-30(ok613) IV; acEx189. |
acEx189 [rab-3p::unc-30 + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by rab-3 neuronal promoter rescues unc-30(ok613) in neurons. Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721. |
| RG3380 |
C11E4.6(ve880[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Homozygous viable. Deletion of 5859 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATAAAGTTGCGTTGTTTCTCAGCTCGAAA ; Right flanking sequence: CGGCATAACAGTCAGCAAACTACTGAGAAC. sgRNA#1: AAGGGCAAAAAGATTCGAAG ; sgRNA #2:AAGGAACAATGGTACGATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3379 |
ugt-47(ve879[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 1932 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCTTCAGTCAGCAATTCATGAACTCCT ; Right flanking sequence: CAATCCTACCATTTGATATTAAATGTGATT. ugt-47 sgRNA #1: GAGTGGGTTATTCAGAATGG; ugt-47 sgRNA #2: CTGATGAATTGGCAAAAGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3381 |
Y38C1AA.6(ve881[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 851 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTGAACAATGTTTCGATCAAAAACATTCCC ; Right flanking sequence: CGGTGTTGGAGTGTTTCAATGAAGATGATG. Y38C1AA.6 sgRNA #1: GTTGCAAATTGGGCATGAAG; Y38C1AA.6 sgRNA #2: AGATTTCCAACTTATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| PD2557 |
rps-10(cc2557)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. |
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226. |
| UP4013 |
bli-4(cs281) I; csEx919. |
csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
| PHX5321 |
bli-4(syb5321[bli-4::SfGFP(int)]) I. |
bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
| PHX3685 |
dpy-17(syb3685[dpy-17::mNG]) III. |
mNeonGreen tag inserted at C-terminus of endogenous dpy-17 locus. GGATACAGAAACTAA -> GGATACAGAAAC^TAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
| PHX3691 |
sqt-3(syb3691[sqt-3::mNG(int)]) V. |
mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
| AY190 |
acEx190. |
acEx190 [tax-2p::CZ::ced-3(p17)::unc-54 3’UTR + lim-6p::ced-3(p15)::NZ::unc-54 3’UTR + myo-3p::mCherry]. Pick mCherry+ to maintain. ASG is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the tax-2 and lim-6 promoters. Strain viable at all temperatures. Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721. |
| RG3388 |
K10B3.1(ve888[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Homozygous viable. Deletion of 1215 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGATCTCGCATTTACTTTTCTGTCTTCCC ; Right flanking sequence: CGGTAAATCCTATTGTTTCATTGTTTCAAA. K10B3.1 sgRNA A: AAGAACAGAACATTGAGAGG; K10B3.1 sgRNA B: CATTTATCACTGATAGATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| SBW115 |
lem-2(sbw5[lem-2::mNeonGreen]) II. |
mNeonGreen tag inserted at C-terminus of endogenous lem-2 locus using self-exising drug selection casette method (described by Hastie et al., 2019 J Microbiol Biol Educ). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https://doi.org/10.1242/jcs.261385. PMID: 37795681. |
| SBW136 |
baf-1(sbw7[mNeonGreen::baf-1]) III. |
mNeonGreen tag inserted at N-terminus of endogenous baf-1 locus using self-excising drug selection cassette method (described by Dickinson, et al. 2015, Genetics). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https://doi.org/10.1242/jcs.261385. PMID: 37795681. |
| SBW308 |
emr-1(sbw16[mNeonGreen::emr-1]) I. |
mNeonGreen tag inserted at N-terminus of endogenous emr-1 locus using self-excising drug selection cassette method (described by Dickinson, et al. 2015, Genetics). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https://doi.org/10.1242/jcs.261385. PMID: 37795681. |
| SBW448 |
lem-2(sbw20) II. |
CRISPR/Cas9-engineered deletion of entire lem-2 locus. Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https://doi.org/10.1242/jcs.261385. PMID: 37795681. |
| CZ27593 |
bli-1(ju1789[bli-1::mNG::3xFLAG]) II. |
Superficially wild type with green fluorescence in L4 epidermis and adult stage cuticle. mNeonGreen and 3xFLAG tags inserted in N-terminus of endogenous BLI-1 locus at A106 (after subtilisin cleavage site) using Dickinson method. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413. |
| PHX3293 |
bli-2(syb3293[bli-2::mNG]) II. |
mNeonGreen tag inserted at C-terminus of endogenous bli-2 locus. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413. |
| CZ29114 |
bli-6(ju1914[bli-6::mNG::3xFLAG]) IV. |
mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413. |
| LE6273 |
src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. |
juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322. |
| LE6897 |
src-1(syb7248)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. |
juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322. |
| NC1749 |
pha-1(e2123) hdIs32 III; otEx239. |
hdIs32 [glr-1::DsRed2] III. otEx239 [rig-3::GFP + pha-1(+)]. Maintain at 25C and pick GFP+ to ensure the array is retained. AVA neurons are marked with GFP and DsRed2. Can be used to isolate AVA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). Derived from parental strain OH4326. Reference: Hutter H. J Microsc. 2004 Aug;215(Pt 2):213-8. doi: 10.1111/j.0022-2720.2004.01367.x. PMID: 15315508. |
| NC2913 |
hdIs1 X; ufIs26. |
hdIs1 [unc-53p::GFP + rol-6(su1006)] X. ufIs26 [unc-4p::mCherry + lin-15(+)]. Rollers. DA neurons marked with unc-4::mCherry and unc-53::GFP. unc-53::GFP expression in DAs is dim during L1. Can be used to isolate DA neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| NC3604 |
myls13; oyIs51. |
myls13 [klp-6p::GFP]. oyIs51 [srh-142::RFP]. IL2 neurons are marked with GFP. ADF neurons are marked with RFP. Derived from parental line PY3470. Can be used to isolate IL2 neurons (GFP) and ADF neurons (RFP) by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| NC3577 |
ufIs26 II; otIs707. |
ufIs26 [unc-4p::mCherry + lin-15(+)] II. otIs707 [bnc-1p(1.8kb)::GFP]. VB neurons are GFP+ only; VA and SABV have both mCherry and GFP. Can be used to isolate VB neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| NC3524 |
ufIs26 II; vsIs13 IV. |
ufIs26 [unc-4p::mCherry + lin-15(+)] II. vsIs13 [lin-11::pes-10::GFP + lin-15(+)] IV. GFP expression in six VC neurons and posterior intestine. VC neurons are labeled with both GFP and mCherry; co-labeling in VCs1-5 is brightest during L4 stage. Derived by crossing parental strains NC2957 and LX959. Can be used to isolate VC neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| NC3296 |
ynIs37 III; juIs223 IV. |
ynIs37 [flp-13::GFP] III. juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. ttr-39::mCherry alone marks VD and DD neurons. ttx-3::GFP marks AIY neurons. Combined ttr-39::mCherry and flp-13::GFP co-expression marks DD neurons in the L2 (only a few mCherry+/GFP+ DD neurons will show up briefly in the L2 stage and gene silencing apparently dims the GFP marker over time). VD neurons can be identified by mCherry alone, no GFP. Derived by crossing parental strains CZ8332 and NY2037. Can be used to isolate VB neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| MSB486 |
mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirEx131. |
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651. |
| MSB577 |
bus-17(br2) X; mirEx123. |
mirEx123 [myo-3p::TeNL::unc-54 3' UTR]. Maintain strain by picking animals with blue fluorescence. bus-17(br2) has mutant defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in muscles. Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346. |
| MSB657 |
eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; lite-1 (ce314) X. |
loxP sites inserted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651. |