| VK2755 |
vkEx2755. |
vkEx2755 [nhx-2p::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing CemOrange2 under the intestinal-specific nhx-2 promoter. Free CemOrange2 is localized to the cytosol. Pick animals with GFP+ pharynx to maintain. Reference: Thomas |
| VK2756 |
vkEx2756. |
vkEx2756 [nhx-2p::CemCardinal2 + myo-2p::GFP]. Wild-type animals expressing CemCardinal2 under the intestinal-specific nhx-2 promoter. Free CemCardinal2 is localized to the cytosol. Pick animals with GFP+ pharynx to maintain. Reference: Thomas |
| VK2797 |
vkIs2797. |
vkIs2797 [nhx-2p::CemOrange2::rab-5 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::RAB-5 under the intestinal-specific nhx-2 promoter. RAB-5 is localized to the early endosome. Integrated; chromosome unknown. Reference: Thomas |
| VK2799 |
vkIs2799. |
vkIs2799 [nhx-2p::glo-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing GLO-1::CemOrange2 under the intestinal-specific nhx-2 promoter. GLO-1 is localized to the lysosome related organelle. Integrated; chromosome unkown. Reference: Thomas |
| VK2877 |
vkIs2877. |
vkIs2877 [nhx-2p::sqst-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing SQST-1::CemOrange2 under the intestinal-specific nhx-2 promoter. SQST-1 is localized to the autophagasome. Integrated; chromosome unknown. Reference: Thomas |
| VK2878 |
vkIs2878. |
vkIs2878 [nhx-2p::CemOrange2::lgg-1 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::LGG-1 under the intestinal-specific nhx-2 promoter. LGG-1 is localized to the autophagasome. Integrated; chromosome unknown. Reference: Thomas |
| VK2881 |
vkIs2881. |
vkIs2881 [nhx-2p::glo-1::CemOrange2 + ges-1p::glo-1::GFP + myo-2p::GFP]. Wild-type animals expressing both GLO-1::CemOrange2 and GLO-1::GFP under the Pnhx-2 and Pges-1 intestinal specific promoters, respectively. Integrated; chromosomes unknown. Reference: Thomas |
| VK2882 |
vkIs2882. |
vkIs2882 [nhx-2p::glo-1::CemOrange2 + vha-6p::lmp-1::GFP + myo-2p::GFP]. Wild-type animals expressing both GLO-1::CemOrange2 and LMP-1::GFP under the Pnhx-2 and Pvha-6 intestinal specific promoters, respectively. Integrated; chromosomes unknown. Reference: Thomas |
| VK2883 |
vkEx2883. |
vkEx2883 [nhx-2p::aqp-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing AQP-1::CemOrange2 under the intestinal-specific nhx-2 promoter. AQP-1 is localized to the aprical and basal PM. Pick animals with GFP+ pharynx to maintain. Reference: Thomas |
| VK3160 |
vkEx3160. |
vkEx3160 [nhx-2p::abt-4::mKate2 + nhx-2p::CemOrange2::tram-1]. Wild-type animals expressing both ABT-4::mKate2 and CemOrange2::TRAM-1 under the nhx-2 intestinal specific promoter. Pick mKate2+ & CemOrange2+ animals to maintain. |
| VK3161 |
vkEx3161. |
vkEx3161 [nhx-2p::abt-4(L162P)::mKate2 + nhx-2p::CemOrange2::tram-1]. Wild-type animals expressing both ABT-4(L162P)::mKate2 and CemOrange2::TRAM-1 under the nhx-2 intestinal specific promoter. Pick mKate2+ & CemOrange2+ animals to maintain. |
| JK3961 |
puf-8(q725)/mIn1[mIs14 dpy-10(e128)] II; lip-1(zh15) IV. |
Pick wild-type GFP+ to maintain. q725 heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ q725 heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP puf-8(q725) II; lip-1(zh15) IV double homozygotes. Homozygous puf-8(q725) II; lip-1(zh15) IV double mutants are ~100% Mog at 20C and ~100% Tumerous at 25C. Reference: Morgan CT, et al. Nat Chem Biol. 2010 Feb;6(2):102-4. |
| WU1854 |
pcn-1(am315[3xFLAG]) IV/nT1 [qIs51] (IV;V). |
Homozygous maternal effect lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP am315 homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. 3xFLAG epitope allows antibody detection of full-length PCN-1. Reference: Kocsisova Z, et al. BMC Dev Biol. 2018 May 30;18(1):12. |
| SSM491 |
ubc-9(iow97[3xFLAG::ubc-9]) IV/nT1[qIs51] (IV;V). |
Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) ubc-9(iow97[3xFLAG::ubc-9]) homozygotes. Maintain the strain by picking wild-type GFP+ worms and checking for correct segregation of progeny. iow97 was created by CRISPR/Cas9 insertion of a 3xflag tag at the N-terminus of the endogenous ubc-9 locus; however, the tagged protein is not fully functional. SSM491 is a replacement for SSM291: analysis shows that in all parameters tested, SSM491 is identical to SSM291, which was genetically unstable and prone to breaking down. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441. |
| WBM1119 |
wbmIs60 III. |
wbmIs60 [pie-1p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (III:7007600). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs60 can be used to direct germline-specific gene expression from the pie-1 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific pie-1 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198. |
| WBM1126 |
wbmIs61 I. |
wbmIs61 [myo-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs61 can be used to direct muscle-specific gene expression from the myo-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198. |
| WBM1140 |
wbmIs65 V. |
wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs65 can be used to direct soma-specific gene expression from the eft-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198. |
| WBM1141 |
wbmIs66 IV. |
wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs66 can be used to direct neuron-specific gene expression from the rab-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific rab-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198. |
| AY132 |
zcIs4 V; vit-2(ac3) X. |
zcIs4 [hsp-4::GFP] V. vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. |
| AY142 |
vit-2(ac3) X. |
vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. |
| AY143 |
flp-21(ok889) V; flp-18(gk3063) X. |
Superficially wild-type. Reference: Singh J & Aballay A. Dev Cell. 2019 Apr 8;49(1):89-99.e4. |
| WBM1179 |
wbmIs76 IV. |
wbmIs76 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs76 can be used to direct soma-specific gene expression from the eft-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198. |
| WBM1153 |
wbmIs72 III. |
wbmIs72 [pie-1p::3XFLAG::GFP::unc-54 3'UTR *wbmIs60] (III:7007600). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs72 exhibits germline-specific GFP expression driven the pie-1 promoter. Derived from parental strain WBM1119 by CRISPR-mediated insertion of GFP downstream of tissue-specific pie-1 promoter inserted as a single copy into the C. elegans genome (wbmIs60). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198. |
| WBM1133 |
wbmIs63 I. |
wbmIs63 [myo-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs61] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs63 exhibits muscle-specific wrmScarlet expression driven the myo-3 promoter. Derived from parental strain WBM1126 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome (wbmIs61). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198. |
| WBM1143 |
wbmIs67 V. |
wbmIs67 [eft-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs65] (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs67 exhibits soma-specific wrmScarlet expression driven the eft-3 promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198. |
| TP66 |
pdi-3(ka1) I. |
mild Dumpy. Reference: Winter AD, et al. Dev Biol. 2007 Aug 15;308(2):449-61. |
| TP67 |
pdi-1(ka3) III. |
Superficially wild-type. Reference: Winter AD, et al. Dev Biol. 2007 Aug 15;308(2):449-61. |
| CGC102 |
mir-61(umn14[lox2272 + myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR Lox511I + Lox2272]) V. |
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by myo-2p::wrmScarlet. Generated in parental strain N2. Rollers. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.] |
| CGC103 |
mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. |
mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. Derived by CRE-meditated excision of SEC in parental strain CGC102, leaving myo-2p::wrmScarlet. |
| CGC104 |
mir-61(umn16[lox2272]) V. |
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC102, leaving disrupted mir-61 locus. |
| CGC110 |
mir-250(umn21[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR Lox511I + Lox2272)] V. |
mir-250 pre-miRNA deletion strain deletion allele in which mir-250 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.] |
| CGC111 |
mir-250(umn22[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272)] V. |
Derived by CRE-meditated excision of SEC in parental strain CGC110, leaving myo-2p::wrmScarlet. |
| CGC112 |
mir-250(umn23[lox2272]) V. |
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC110, leaving disrupted mir-250 locus. |
| XE1489 |
wpEx146. |
wpEx146 [dat-1p::MYR::tdKillerRed + dat-1p::GFP]. Pick GFP+ to maintain. KillerRed expression in acetylcholine neurons. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpEx146 carries a tandem dimer version of KillerRed targeted to the plasma membrane through the addition of a myristoylation tag (mry-tdKillerRed). Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63. |
| XE1935 |
wpIs98 I. |
wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. Chrimson is expressed in DA9. Use 100 uM ATR in OP50 for optogenetic experiments. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829. |
| XE1057 |
eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |
| XE1002 |
unc-70(s1502) V; oxIs12 X. |
oxIs12 [unc-47p::GFP + lin-15(+)]. Unc. Reference: Hammarlund M, et al. J Cell Biol. 2000 May 15;149(4):931-42. [NOTE: this strain grows very slowly and will take longer than usual to prepare for shipping.] |
| XE1995 |
wpIs98 I; ric-7(n2657) V; wpIs103. |
wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. wpIs103 [myo-3p::GCaMP6 + myo-2p::mCherry]. ric-7 causes defective expulsion during defecation and slightly slow growth. Chrimson is expressed in DA9. GCaMP6 expressed in body wall muscles. Use 100 uM ATR in OP50 for optogenetic experiments. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829. |
| XE2045 |
ric-7(n2657) V; ufIs92; wpIs109. |
ufIs92 [unc-47p::acr-12::GFP]. wpIs109 [itr-1pB::mCherry + odr-1p::RFP]. ric-7 causes defective expulsion during defecation and slightly slow growth. ACR-12::GFP expression in GABA neurons. DA9 is labeled with mCherry. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829. |
| XE1931 |
ric-7(n2657) V; wpIs101. |
wpIs101 [itr-1pB::GFP:::rab-3::SL2::mCherry + myo-2p::mCherry]. DA9 and its presynapses labeled. ric-7 causes defective expulsion during defecation and slightly slow growth. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829. |
| RG3043 |
T12A7.2(ve543[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 2862 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tttttgtaagtaaatttgaaatacccggta ; Right flanking sequence: tgaggaaaagaaatattgattaggcgtatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3044 |
+/mT1[umnIs52] II; rpn-3(ve544[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous arrest at larval stage. Deletion of 1779 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (ve544 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: ttcaaattttaaagggaaATGGCTCCGAAA ; Right flanking sequence: ccgaatgaattttataaggatgaattgcat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3045 |
Y38C1AA.9(ve545[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 1665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gtaattgctcataaagatataaaaccccTT ; Right flanking sequence: CAATCACGTGCACTTTTTCGGCATGAATCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3046 |
C46G7.1(ve546[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 1523 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, larval lethal GFP+ non-mKate2 (ve546 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatacaatttacaggtaaaagccggcaac ; Right flanking sequence: ATCGGAATTGCAGTTCTTCTTTCACTTCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3047 |
+/mT1[umnIs52] II; K12H4.5(ve547[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous lethal. Deletion of 418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal GFP+ non-mKate2 (ve547 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaattaattaatttataatgtgatcctttt ; Right flanking sequence: agtcgtagacgattttcgattttcactgta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| EU1485 |
ltIs37 IV; orIs13. |
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs13 [pie-1p::GFP::npp-22(genomic)::pie-1 3'UTR + unc-119(+)]. GFP-tagged NPP-22. Superficially wild-type. Might still carry unc-119(ed3) in background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: O'Rourke SM, et al. PLoS Genet. 2007 Aug;3(8):e128. |
| LP177 |
unc-119(ed3) III; che-12(cp26[GFP + LoxP + unc-119(+) + LoxP]) V. |
Entire che-12 coding sequence deleted and replaced with GFP. This produced a phenotype that is more penetrant than that reported for the original che-12 strain, which introduced a nonsense mutation midway through the coding region. Short amphid and phasmid cilia. Defective chemotaxis to NaCl. Dye-filing defective. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64. |
| LN130 |
rcIs31II; ltIs37 IV. |
rcIs31 [pie-1p::GFP::ubiquitin + unc-119] II. ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP::ubiquitin is visible in the germline when worms are grown at 25C. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Al Rawi S, et al. Science. 2011 Nov 25;334(6059):1144-7. |
| LN162 |
ltIs37 IV; avIs116. |
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. avIs116 [pie-1p::GFP::ubiquitinAA + unc-119(+)]. GFP::ubiquitinAA is visible in the germline when raised at 25C. GFP::ubiquitinAA is a mutated form of ubiquitin that has a dialanine at the C-terminus instead of the diglycine required for conjugation onto protein substrates. Useful control strain for LN130. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Sampuda KL, et al. BMC Cell Biol. 2017 Apr 19;18(1):18. |
| LN151 |
rcSi1 II; unc-119(ed3) III. |
rcSi1 [mex-5p::rpt-1::mCherry + unc-119(+)] II. RPT-1::mCherry allows visualization of the proteasome in the germline. Reference: Sampuda KL, et al. BMC Cell Biol. 2017 Apr 19;18(1):18. |
