| LN167 |
rpn-6.2(rc2[rpn-6.2::GFP]) III. |
RPN-6.2 is a sperm-specific proteasome subunit. CRISPR/Cas9 GFP insertion. Robust RPN-6.2::GFP expression in developing and mature sperm. |
| LN170 |
rpn-6.2(rc3[GFP + SEC::rpn-6.2b]) III. |
Roller. Reduced brood size and reduced sperm count. CRISPR/Cas9 GFP insertion at amino acid 216 of RPN-6.2a. Expression of GFP in the spermatogenic germline. The SEC (self excising cassette) contains the stop codon and transcriptional termination signal for GFP as well as a sqt-1(d) allele. Pick rollers to maintain the strain with the SEC. Excision will result in an in frame fusion of GFP at amino acid 216 of RPN-6.2a or amino acid 5 of RPN-6.2b. |
| AT28 |
kyIs140 I; srf-6(yj13) unc-4(e120) II. |
kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4). |
| AT30 |
kyIs140 I; nsy-1(ok593) unc-4(e120) II. |
kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons. |
| YL139 |
meg-1(vr10) X. |
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: AGATGCCACATACAAACGCT / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306. |
| MAD63 |
dqSi1 II; unc-119(ed3) III. |
dqSi1 [mex-5p::atx-2a(cDNA)::GFP::tbb-2 3’UTR + unc-119(+)] II. Made by injection into strain EG6699; insertion confirmed by sequencing. dqSi1 rescues atx-2(ne4297). Reference: Gnazzo MM, et al. Mol Biol Cell. 2016 Oct 15;27(20):3052-3064. (PMID: 27559134) Del Castillo U, et al. Traffic. 2019 Jun;20(6):436-447. (PMID: 30989774) |
| YY538 |
hrde-1(tm1200) III. |
Maintain at 15C. Heritable RNAi defective, germline mortality (Mrt) at 25C. Reference: Buckley BA, et al. Nature. 2012 Sep 20;489(7416):447-51. |
| CGC113 |
mir-61&mir-250(umn24[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR Lox511I + Lox2272)] V. |
mir-61&mir-250 pre-miRNA deletion strain deletion allele in which mir-61&mir-250 pre-miRNAs were replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.] |
| CGC114 |
mir-61&mir-250(umn25[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272)] V. |
Derived by CRE-meditated excision of SEC in parental strain CGC113, leaving myo-2p::wrmScarlet. |
| CGC115 |
mir-61&mir-250(umn26[lox2272]) V. |
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC113, leaving disrupted mir-61&mir-250 loci. |
| RG3049 |
K07E1.1(ve549[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 979 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tattttctcctgctttcagttttgatttcc ; Right flanking sequence: ccatctgtcttgtaaatagagctctcttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3051 |
decr-1.3(ve551[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1260 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCCACGAATAACGTTCTCAACATCTCC ; Right flanking sequence: cgtggaacaccctttttaatctttaaactt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| AMH1 |
unc-33(e204) IV; sosIs5. |
sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc. |
| AMH3 |
unc-33(mn407) IV; sosIs5. |
sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc. |
| AMH5 |
unc-119(ed3) III; sosIs5. |
sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. |
| AMH7 |
unc-51(e369) V; sosIs5. |
sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc. Slow growth. |
| AMH11 |
wpIs36 I; sosIs5. |
wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. |
| AMH13 |
wpIs36 I; unc-33(e204) IV; sosIs5. |
wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc. |
| AMH23 |
wpIs36 I; unc-33(e1193) IV; sosIs5. |
wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc; almost paralyzed. Growth slow. |
| AMH25 |
dhc-1(or352) I; sosIs5. |
sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Maintain at 15 degrees. Temperature-sensitive embryonic lethal. 100% dead embryos at 25 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis. |
| AMH26 |
unc-104(e1265) II; sosIs5. |
sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc. Slow moving. |
| AMH30 |
juIs76 II; daf-2(e1370) III. |
juIs76 [unc-25p::GFP + lin-15(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. |
| AMH31 |
juIs76 II; unc-33(e1193) IV. |
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc; almost paralyzed. Growth slow. |
| AMH32 |
juIs76 II; unc-33(mn407) IV. |
juIs76 [unc-25p::GFP + lin-15(+)] II. |
| AMH34 |
juIs76 II; unc-33(e204) IV. |
juIs76 [unc-25p::GFP + lin-15(+)] II. |
| AMH36 |
juIs76 II; daf-2(e1370) III; unc-33(mn407) IV. |
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Maintain at 15C. Synthetic Lethality at 25C. |
| AMH38 |
juIs76 II; daf-2(e1370) III; unc-33(e204) IV. |
juIs76 [unc-25p::GFP + lin-15(+)] II. |
| AMH43 |
unc-33(e204) IV; adIs2122. |
adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Unc. |
| AMH46 |
juIs76 II; daf-2(e1370) III; unc-33(e1193) IV. |
Maintain at 15C. Synthetic Lethality at 25C. Unc; almost paralyzed. Growth slow. |
| AMH50 |
juIs76; bec-1(ok691) IV/nT1 [qIs51] (IV;V). |
juIs76 [unc-25p::GFP + lin-15(+)] II. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-pharyngeal GFP bec-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. |
| AMH55 |
daf-2(e1370) III; otIs117 IV. |
otIs117 [unc-33p::GFP + unc-4(+)] IV. Maintain at 15C. Temperature-sensitive dauer constitutive. Pan-neuronal GFP. |
| AMH57 |
unc-33(mn407); olaEx3013. |
olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144 |
| AMH59 |
unc-33(e204); olaEx3013. |
olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Paralyzed Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144 |
| AMH61 |
unc-13(e51) I; ddi-1(ok1468) IV. |
ddi-1 also known as vsm-1. |
| AMH67 |
unc-33(e204) IV; daf-2(e1370) III. |
Maintain at 15C. Synthetic Lethality at 25C. |
| AMH69 |
unc-33(mn407) IV; daf-2(e1370) III. |
Maintain at 15C. Synthetic Lethality at 25C. |
| AMH71 |
unc-33(e1193) IV; daf-2(e1370) III. |
Maintain at 15C. Synthetic Lethality at 25C. |
| AMH73 |
ddi-1(ok1468) IV; sosIs6. |
sosIs6 [C01G5.6p::C01G5.6::GFP]. ddi-1 also known as vsm-1. |
| AMH82 |
ccIs4251 I; ddi-1(ok1468) IV. |
ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. ddi-1 also known as vsm-1. |
| AMH96 |
sosIs3. |
sosIs3 [unc-119p::ddi-1::GFP]. ddi-1 also known as vsm-1. |
| AT24 |
srf-6(yj15) II. |
No visible phenotype. Whole genome sequenced strain. |
| RG3050 |
T01D1.4(ve550[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgtctgatgtagaagtttagttgttgtgg ; Right flanking sequence: TGTGGGAGACGACGATCTCCGCATGGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| PS7731 |
K03E5.2(sy1082) I. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT;
right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG
Reference: Wang H, et al. G3 (Bethesda). |
| PS7778 |
clik-1(sy1084) V. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6)
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG;
right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda). |
| PS7833 |
Y106G6H.8(sy1076) I. |
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of Y106G6H.8
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GTAATCTCCCCACCAAGTGTCGATATGTCTCCAATT;
right flanking sequence: ATTCGTCTGGCTGGCCTCTCGGGAGCTGTTGCCATTTC;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda). |
| PS7909 |
C56G2.15(sy1120) III. |
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C56G2.15.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CTCGTGAGCATTCACAGAAAAAATCATGCCGTCA;
right flanking sequence: GTCCCCTCCAATGTCGTTTTTGTTGCTCAATAAGG;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda). |
| PS7911 |
C53C9.2(sy1122)/tmC30[ubc-17(tmIs1243)] X. |
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2.
lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG;
right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda). |
| PS8010 |
cpn-4(sy1172) I. |
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of cpn-4 (F49D11.8).
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GGCAAGCAAGTTCAATGATGTTGAAGCTGGATACT;
right flanking sequence: TGTTGGAATGGATTCGGgtaagatttgggtagatt;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda). |
| AY131 |
zcIs4 V; vit-1(ac2) X. |
zcIs4 [hsp-4::GFP] V. vit-1(ac2) is a dominant allele that causes ER stress. Since vit-1 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. |
| AY133 |
zcIs4 V; vit-4(ac4) X. |
zcIs4 [hsp-4::GFP] V. vit-4(ac4) is a dominant allele that causes ER stress. Since vit-4 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. |
