| EU3030 |
ijmSi3 I; unc-119(ed3) III; ltIs37 IV. |
ijmSi3 [mex-5p::cls-2(re-encoded)::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The coding sequence of GFP-tagged cls-2 in the transgene was re-coded using silent mutations to render it insensitive to RNAi-depletion of endogenous cls-2 expression. mCherry expression marks histones. Not known if unc-119(ed3) is still carried in the background of this strain. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Schlientz A and Bowerman B. PLoS Genet. 2020 Oct 7;16(10):e1008751. doi: 10.1371/journal.pgen.1008751. |
| HBR1899 |
goeIs406. |
goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1914 |
goeIs413. |
goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| MSB115 |
unc-70(mir6[loxP] mir16[loxP]) V. |
Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987 |
| MSB273 |
syIs423 V; mirIs19. |
syIs423 [15xUAS::Δpes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. mirIs19 [nlp-12p::gal-4 + unc-122p::mCherry]. Maintain animals at 25C for several generations to enhance mKate expression in DVA to make it visible with a fluorescence dissection scope. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987 |
| MSB510 |
mirIs37. |
mirIs37 [acr-5p::CRE + myo-2p::mCherry]. Superficially wild-type. CRE expression is driven predominantly in B-type motor neurons; CRE activity has also been observed in a few other cells. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987 |
| MSB340 |
mirEx96. |
mirEx96 [flp-22p::CRE + unc-122p::mCherry]. Pick animals with red fluorescence in coelomocytes to maintain the array. SMD-specific CRE driver. Superficially wild-type. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987 |
| MSB513 |
mirIs42. |
mirIs42 [F49H12.4p::CRE + myo-2p::mCherry]. Superficially wild-type. Primarily PVD-specific CRE driver; CRE activity was observed predominantly in PVD neurons with some additional recombination in a few tail neurons and possibly FLP neuron. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987 |
| MSB591 |
trp-4(mir35mir36[trp-4::gfp]) I. |
GFP tag inserted into the N-terminus of the endogenous trp-4 locus using a two-step nested CRISPR method. The GFP signal is more prominent on the tip of the nose of the animals. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987 |
| MSB555 |
twk-16(syb2541[wrmScarlet::degron::twk-16]) X. |
wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987 |
| MSB778 |
mirIs71. |
mirIs71 [nlp-12p::CRE + myo-2p::mCherry]. DVA-specific CRE driver. Superficially wild-type. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987 |
| GKC1 |
mip-1(uae1) III. |
Temperature-sensitive sterile; maintain at 15-20C. uae1 is a CRISPR-engineered deletion of the mip-1 coding region. Reference: Cipriani PG. et al. Elife. 2021 Jul 5;10:e60833. doi: 10.7554/eLife.60833. |
| GKC2 |
mip-2(uae2) V. |
Temperature-sensitive sterile; maintain at 15-20C. uae2 is a CRISPR-engineered deletion of the mip-2 coding region. Reference: Cipriani PG. et al. Elife. 2021 Jul 5;10:e60833. doi: 10.7554/eLife.60833. |
| MT18778 |
nIs348 IV; lin-15AB(n765) X. |
nIs348 [ceh-28p::4XNLS::mCherry + lin-15(+)] IV. Reporter construct contains 2.4 kb of ceh-28 promoter. Reference: Hirose T, et al. Proc Natl Acad Sci. 2010 Aug 31;107(35):15479-84. PMID: 20713707 |
| MT21910 |
lin-15AB(n765) X; nEx2065. |
nEx2065 [gur-3p::GFP + lin-15(+)]. Maintain by picking non-Muv. GFP expression in I2, I4, AVD and PVC. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. PMID: 25640076. |
| PT3406 |
nekl-4(my51[nekl-4::mNeonGreen]) III; him-5(e1490) V. |
mNeonGreen tag inserted into endogenous nekl-4 locus by CRISPR/Cas9 engineering. Very faint mNeonGreen expression in the dendrites, soma, and axons of all ciliated neurons. Reference: Power KM, et al. PLoS Genet. 2020 Oct 16;16(10):e1009052. PMID: 33064774 |
| ZM9474 |
flp-14(gk1055) III; hpSi38. |
hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782 |
| PHX3601 |
pah-1(syb3601) II. |
Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT. |
| PHX3634 |
pah-1(syb3634[GFP::H2B::T2A::pah-1]) II. |
Superficially wild-type. GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9. |
| PHX3678 |
tph-1(mg280) pah-1(syb3678[GFP::H2B::T2A::pah-1]) II. |
GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9. |
| PHX5218 |
cest-4(syb5218[cest-4::SL2::GFP::H2B]) IV. |
GFP tag inserted into endogenous cest-4 locus by CRISPR/Cas9. |
| PHX5923 |
bas-1(syb5923[bas-1::SL2::GFP::H2B]) III. |
GFP tag inserted into endogenous bas-1 locus by CRISPR/Cas9. |
| IX4506 |
mls-2(vy248[mNG::mls-2]) X. |
mNG tag inserted into endogenous mls-2 locus after the start codon using CRISPR/Cas9 engineering, producing a translational mNG::MLS-2 reporter protein. Derived by SEC excision of mls-2(vy247[mNG::SEC::mls-2 knock-in]) in parental strain. mNG::MLS-2 is detected in the nucleus of a few cells in embryos, and localizes to the nucleus of a subset of head cells and the M mesoblast in larvae and adults. Reference: Xiong R., et al. (2022). mNG-tagged mls-2 knock-in alleles in C. elegans. microPublication Biology. 10.17912/micropub.biology.000529. |
| BFF53 |
bqSi577 IV. |
bqSi577 [myo-2p::GFP + unc-119(+)] IV. Expresses GFP in pharyngeal muscles. Single-copy insertion in the MosSCI locus cxTi10882 on chromosome IV. Obtained via the outcrossing of strain BN578 with N2. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343. |
| OH17241 |
unc-86(ot1158) III. |
unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095. |
| OH16636 |
pha-1(e2123) III; otIs669 him-5(e1490) V; otEx7603. |
otEx7603 [nlp-52p::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. The nlp-52 reporter construct contains the full intergenic region of nlp-52 as the promoter. GFP expression in a subset of cells of the nervous system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095. |
| PHX3195 |
flp-33(syb3195[flp-33::T2A::3xNLS::GFP]) I. |
GFP tag inserted into endogenous flp-33 locus using CRISPR/Cas9 engineering. GFP expression in ADE (in head). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095. |
| PHX5073 |
ceh-43(syb5073[ceh-43::SL2::GFP::H2B]) III. |
GFP tag inserted into endogenous ceh-43 locus using CRISPR/Cas9 engineering. GFP expression in IL1, CEP, AIN, AIZ, ASJ, ADE, BDU, SDQ, PDE, PVQ, and possibly glia. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095. |
| RP3497 |
idpc-1(knu1089[Y47D3B.6::mGreenLantern]) III. |
mGreenLantern tag inserted at the C-terminus of the endogenous idpc-1/Y47D3B.6 locus. mGreenLantern expression in the pharyngeal cuticle. Reference: Kamal M, et al. "A Spatiotemporal Reconstruction of the C. elegans Pharyngeal Cuticle Reveals a Structure Rich in Phase-Separating Proteins." https://www.biorxiv.org/content/10.1101/2022.03.11.483951v1 |
| MCJ180 |
mir-35(cdb2 cdb72) II. |
cdb2 cdb72 is a mutation to the 3' end of the mature mir-35 creating a 3’ end containing nucleotides that are not present or rare among all mir-35 family members at a given position, while preserving overall GC content. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports. |
| MCJ191 |
mir-35(cdb2 cdb78) II. |
cdb2 cdb78 is a mutation to the 3' end of the mature mir-35 creating a mutant with mir-35 seed sequence and mir-82 3’ end. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports. |
| MCJ219 |
sup-26(cdb99) nhl-2(cdb100) III; egl-1(cdb97) V. |
nhl-2(cdb100) contains engineered mutations in the mir-35 binding site in the nhl-2 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the egl-1 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Slightly reduced brood size at 25C. Reference: Donnelly BF, et al. (2022). Cell Reports. |
| RP3513 |
trEx1006. |
trEx1006 [fipr-4p::fipr-4::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951. |
| RP3515 |
trEx1008. |
trEx1008 [idpa-3p::idpa-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951. |
| RP3498 |
trEx1001. |
trEx1001 [idpb-3p::idpb-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951. |
| RP3439 |
tris113. |
trIs113 [abu-14p::abu-14::GFP + rol-6(su1006)]. Rollers. Integrated line generated from an extrachromosomal array provided by David Raizen. References: George-Raizen JB, et al. Biol Open. 2014 Oct 31;3(11):1139-49. PMID: 25361578. Kamal M, et al. bioRxiv 2022.04.11.487937; doi: https://doi.org/10.1101/2022.04.11.487937. |
| RP3510 |
trEx1010. |
trEx1010 [pgp-14p::sms-5B(genomic)::Flag::mCherry + pgp-14p::YFP::pgp-14]. Pick animals with mCherry+ pharynx to maintain. Fluorescence is more apparent in older animals (late stage larvae to young adults). Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951. |
| PHX5500 |
ceh-44(syb5500[ceh-44::oxGFP]) III. |
oxGFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5437 |
cone-1(syb5437[gfp::cone-1]) III. |
GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. [NOTE: Previously described as ceh-44(syb5437[gfp::ceh-44]) III. ceh-44 and cone-1 are located in the same locus and may share many exons, but are two separate genes with different functions and expression patterns. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5843 |
ceh-44(syb5843[ceh-44::gfp(exon8)]) III. |
GFP tag inserted at the N-terminus of the endogenous ceh-44 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6281 |
ceh-44(syb6281[ceh-44::gfp(exon7)]) III. |
GFP tag inserted at exon 7 of the endogenous ceh-44 locus by CRISPR. Nuclear pan-neuronal nuclear and broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6499 |
unc-75(syb6499[gfp::unc-75]) I. |
GFP tag inserted at the N-terminus of the endogenous unc-75 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6547 |
golg-4(syb6547[wrmScarlet::golg-4]) III. |
wrmScarlet tag inserted at the N-terminus of the endogenous golg-4 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6680 |
golg-2(syb6680[wrmScarlet::golg-2]) II. |
wrmScarlet tag inserted at the N-terminus of the endogenous golg-2 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6898 |
cone-1(syb6898 [cone-1::T2A::GFP::H2B]) III. |
GFP tag inserted at C-terminus of endogenous cone-1 locus by CRISPR. Broad nuclear GFP expression in non-neuronal cells. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| OD2283 |
ltSi569 I; ltSi592 II; unc-119(ed3) III. |
ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi592 [spd-2p::gfp::spd-5(S653A S658A, re-encoded) + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled gamma tubulin. GFP-labeled centrioles. Derived by crossing parental strains OD1801 with OD1709. Reference: Woodruff JB, et al. Science. 2015 May 15;348(6236):808-12. doi: 10.1126/science.aaa3923. PMID: 25977552 |
| OD2435 |
ltSi569 I; ltSi1141 II; unc-119(ed3) III. |
ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi1141 [spd-2p::gfp::spd-5(re-encoded) + Cbr-unc-119(+)] II. Re-encoded spd-5 is siRNA-resistant. mCherry-labeled gamma tubulin. GFP-labeled centrioles. Reference: Woodruff JB, et al. Science. 2015 May 15;348(6236):808-12. doi: 10.1126/science.aaa3923. PMID: 25977552 |
| OD4235 |
ltSi220 I; ltSi1129 II; unc-119(ed3) III. |
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1129 [spd-2p::spd-5(re-encoded) + Cbr-unc-119(+)] II.
Re-encoded spd-5 is siRNA-resistant. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854. |
| OD4313 |
ltSi220 I; ltSi1219 II; unc-119(ed3) III. |
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1219 [spd-2p::spd-5(S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854. |
| OD4467 |
ltSi220 I; ltSi1232 II; unc-119(ed3) III. |
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1232 [spd-2p::spd-5(S170A T178A T198A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854. |