Species Information: C elegans

Name C elegans
NCBI Taxonomy ID

C elegans strains available at the CGC

Strain Genotype Description
MJS276 unc-119(ed3) III; qbcSi12 IV. qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
MJS277 unc-119(ed3) III; qbcSi11 IV. qbcSi11 [elt-1p::GFP::his-58::3XmiR-228::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
AY191 acEx191. acEx191 [odr-2p::CZ::ced-3(p17)::unc-54 3’UTR+ unc-53p::ced-3(p15)::NZ::unc-54 3’UTR + rol-6(su1006)]. Pick Rollers to maintain.  PVP is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the odr-2 and unc-53 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721.
WRM31 sprDf1 V/nT1 [qIs51] (IV,V). Pick GFP+ to maintain. sprDf1 is a ~0.25 Mb microdeletion allele on the left arm of chromosome V that removes 32 adjacent protein-coding genes, including mex-5. Heterozygous animals (GFP+) are fertile, but sometimes die by bursting, will have polynucleated embryos, and form uterine tumors ~6 days after hatching. sprDf1 homozygotes (GFP-) have maternal effect lethality, are small, sterile, form large uterine tumors that consist of poly nucleated embryos, have squashed vulvas, are uncoordinated, and die by bursting within eight days of hatching. nT1 homozygotes are inviable (dead eggs). Reference: Antkowiak KR, et al. G3 (Bethesda). 2023 Nov 13:jkad258. doi: 10.1093/g3journal/jkad258. PMID: 37956108.
MT15894 vps-50(n4022) III. vps-50 mutants are abnormal in locomotion and egg laying. n4022 is a strong loss-of-function allele; unknown if null. Reference: Paquin N, et al. Curr Biol. 2016 Apr 4;26(7):862-71. doi: 10.1016/j.cub.2016.01.049. PMID: 26948874.
PX725 fxSi8 I. fxSi8 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi8 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi8 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX726 fxSi9 I. fxSi9 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi9 is a CRISPR-engineered site in the MY16 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi9 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX727 fxSi10 I. fxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX728 fxSi11 I. fxSi11 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi11 is a CRISPR-engineered site in the JU775 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi11 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX736 fxSi13 III. fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).
JH3308 gtbp-1(ax5000[gtbp-1::tagRFP]) IV. tagRFP tag inserted into endogenous gtbp-1 locus. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.