| MJS276 |
unc-119(ed3) III; qbcSi12 IV. |
qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155. |
| MJS277 |
unc-119(ed3) III; qbcSi11 IV. |
qbcSi11 [elt-1p::GFP::his-58::3XmiR-228::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155. |
| AY191 |
acEx191. |
acEx191 [odr-2p::CZ::ced-3(p17)::unc-54 3’UTR+ unc-53p::ced-3(p15)::NZ::unc-54 3’UTR + rol-6(su1006)]. Pick Rollers to maintain. PVP is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the odr-2 and unc-53 promoters. Strain viable at all temperatures. Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721. |
| WRM31 |
sprDf1 V/nT1 [qIs51] (IV,V). |
Pick GFP+ to maintain. sprDf1 is a ~0.25 Mb microdeletion allele on the left arm of chromosome V that removes 32 adjacent protein-coding genes, including mex-5. Heterozygous animals (GFP+) are fertile, but sometimes die by bursting, will have polynucleated embryos, and form uterine tumors ~6 days after hatching. sprDf1 homozygotes (GFP-) have maternal effect lethality, are small, sterile, form large uterine tumors that consist of poly nucleated embryos, have squashed vulvas, are uncoordinated, and die by bursting within eight days of hatching. nT1 homozygotes are inviable (dead eggs). Reference: Antkowiak KR, et al. G3 (Bethesda). 2023 Nov 13:jkad258. doi: 10.1093/g3journal/jkad258. PMID: 37956108. |
| MT15894 |
vps-50(n4022) III. |
vps-50 mutants are abnormal in locomotion and egg laying. n4022 is a strong loss-of-function allele; unknown if null. Reference: Paquin N, et al. Curr Biol. 2016 Apr 4;26(7):862-71. doi: 10.1016/j.cub.2016.01.049. PMID: 26948874. |
| PX725 |
fxSi8 I. |
fxSi8 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi8 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi8 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014). |
| PX726 |
fxSi9 I. |
fxSi9 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi9 is a CRISPR-engineered site in the MY16 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi9 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014). |
| PX727 |
fxSi10 I. |
fxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014). |
| PX728 |
fxSi11 I. |
fxSi11 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi11 is a CRISPR-engineered site in the JU775 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi11 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014). |
| PX736 |
fxSi13 III. |
fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894). |
| JH3308 |
gtbp-1(ax5000[gtbp-1::tagRFP]) IV. |
tagRFP tag inserted into endogenous gtbp-1 locus. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687. |
| SJZ106 |
foxSi27 I. |
foxSi27 [pie-1p::tomm-20(gDNA)::mKate2::HA::tbb-2 3'UTR ] I. Single-copy MosSCI insertion into oxti185. Germline-specific expression of TOMM-20::mKate2::HA can be used for fluorescent identification of germline mitochondrial morphology and tissue-specific isolation of mitochondria. Reference: Ahier A, et al. Nature Cell Biol. 2018 Mar;20(3):352-360. doi: 10.1038/s41556-017-0023-x. PMID: 29358705. |
| DCR9089 |
olaIs138 IV. |
olaIs138 [ttx-3p::SL2::HYlight::let-858 3'UTR + elt-7p::mCherry] IV. Expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells, in the neuron pair AIY. Derived by UV/TMP insertion of the olaEx5367 transgene. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527. |
| DCR8892 |
olaEx5331. |
olaEx5331 [rab-3p::HYlight-RA + elt-7p::mCherry]. Pick mCherry+ animals to maintain. Pan-neuronal expression of HYlight-RA, a reduced affinity version of the FBP biosensor that does not respond to changes in concentration of the FBP metabolite during hypoxia in vivo. Can be used as a negative control for HYlight sensor in strain DCR8881. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527. |
| DCR8881 |
olaEx5329. |
olaEx5329 [rab-3p::HYlight + elt-7p::mCherry]. Pick mCherry+ animals to maintain. Pan-neuronal expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527. |
| JTL720 |
haps-1(ljt1) I. |
CRISPR-engineered KO strain of haps-1 made by knock-in of tandem stop codons to the first exon of endogenous haps-1 locus. haps-1(C48B6.3) is the C. elegans ortholog of human HAPSTR1. haps-1(ljt1) is superficially wild-type when cultured at 20C, but is hypersensitive to paraquat (redox stress), MLN4924 (neddylation inhibition), and camptothecin (genotoxic stress). Reference: Amici DR, et al. Proc Natl Acad Sci U S A. 2022 Jul 5;119(27):e2111262119. doi: 10.1073/pnas.2111262119. PMID: 35776542. |
| OH19204 |
golg-4(ot1508[GFP::golg-4]) III. |
GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| OH19205 |
golg-4(ot1509[mScarlet3::golg-4]) III. |
mScarlet3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| OH19206 |
golg-4(ot1510[mScarlet-I3::golg-4]) III. |
mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| OH19124 |
pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. |
SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| OH19125 |
pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. |
GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| OH19299 |
unc-75(ot1539[mScarlet-I3::unc-75]) I. |
mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| PHX7515 |
dve-1(syb7515[dve-1::AID::mScarlet]) X. |
AID::mScarlet tag inserted into endogenous dve-1 locus via CRISPR/Cas9 engineering. Reference: Alexander, K.D. et al. Nat Commun 2023 Nov 18;14(1):7520. PMID: 37980357. |