| MJS276 |
unc-119(ed3) III; qbcSi12 IV. |
qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155. |
| MJS277 |
unc-119(ed3) III; qbcSi11 IV. |
qbcSi11 [elt-1p::GFP::his-58::3XmiR-228::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155. |
| AY191 |
acEx191. |
acEx191 [odr-2p::CZ::ced-3(p17)::unc-54 3’UTR+ unc-53p::ced-3(p15)::NZ::unc-54 3’UTR + rol-6(su1006)]. Pick Rollers to maintain. PVP is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the odr-2 and unc-53 promoters. Strain viable at all temperatures. Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721. |
| WRM31 |
sprDf1 V/nT1 [qIs51] (IV,V). |
Pick GFP+ to maintain. sprDf1 is a ~0.25 Mb microdeletion allele on the left arm of chromosome V that removes 32 adjacent protein-coding genes, including mex-5. Heterozygous animals (GFP+) are fertile, but sometimes die by bursting, will have polynucleated embryos, and form uterine tumors ~6 days after hatching. sprDf1 homozygotes (GFP-) have maternal effect lethality, are small, sterile, form large uterine tumors that consist of poly nucleated embryos, have squashed vulvas, are uncoordinated, and die by bursting within eight days of hatching. nT1 homozygotes are inviable (dead eggs). Reference: Antkowiak KR, et al. G3 (Bethesda). 2023 Nov 13:jkad258. doi: 10.1093/g3journal/jkad258. PMID: 37956108. |
| MT15894 |
vps-50(n4022) III. |
vps-50 mutants are abnormal in locomotion and egg laying. n4022 is a strong loss-of-function allele; unknown if null. Reference: Paquin N, et al. Curr Biol. 2016 Apr 4;26(7):862-71. doi: 10.1016/j.cub.2016.01.049. PMID: 26948874. |
| PX725 |
fxSi8 I. |
fxSi8 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi8 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi8 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014). |
| PX726 |
fxSi9 I. |
fxSi9 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi9 is a CRISPR-engineered site in the MY16 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi9 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014). |
| PX727 |
fxSi10 I. |
fxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014). |
| PX728 |
fxSi11 I. |
fxSi11 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi11 is a CRISPR-engineered site in the JU775 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi11 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014). |
| PX736 |
fxSi13 III. |
fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894). |
| JH3308 |
gtbp-1(ax5000[gtbp-1::tagRFP]) IV. |
tagRFP tag inserted into endogenous gtbp-1 locus. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687. |
| SJZ106 |
foxSi27 I. |
foxSi27 [pie-1p::tomm-20(gDNA)::mKate2::HA::tbb-2 3'UTR ] I. Single-copy MosSCI insertion into oxti185. Germline-specific expression of TOMM-20::mKate2::HA can be used for fluorescent identification of germline mitochondrial morphology and tissue-specific isolation of mitochondria. Reference: Ahier A, et al. Nature Cell Biol. 2018 Mar;20(3):352-360. doi: 10.1038/s41556-017-0023-x. PMID: 29358705. |
| DCR9089 |
olaIs138 IV. |
olaIs138 [ttx-3p::SL2::HYlight::let-858 3'UTR + elt-7p::mCherry] IV. Expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells, in the neuron pair AIY. Derived by UV/TMP insertion of the olaEx5367 transgene. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527. |
| DCR8892 |
olaEx5331. |
olaEx5331 [rab-3p::HYlight-RA + elt-7p::mCherry]. Pick mCherry+ animals to maintain. Pan-neuronal expression of HYlight-RA, a reduced affinity version of the FBP biosensor that does not respond to changes in concentration of the FBP metabolite during hypoxia in vivo. Can be used as a negative control for HYlight sensor in strain DCR8881. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527. |
| DCR8881 |
olaEx5329. |
olaEx5329 [rab-3p::HYlight + elt-7p::mCherry]. Pick mCherry+ animals to maintain. Pan-neuronal expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527. |
| JTL720 |
haps-1(ljt1) I. |
CRISPR-engineered KO strain of haps-1 made by knock-in of tandem stop codons to the first exon of endogenous haps-1 locus. haps-1(C48B6.3) is the C. elegans ortholog of human HAPSTR1. haps-1(ljt1) is superficially wild-type when cultured at 20C, but is hypersensitive to paraquat (redox stress), MLN4924 (neddylation inhibition), and camptothecin (genotoxic stress). Reference: Amici DR, et al. Proc Natl Acad Sci U S A. 2022 Jul 5;119(27):e2111262119. doi: 10.1073/pnas.2111262119. PMID: 35776542. |
| OH19204 |
golg-4(ot1508[GFP::golg-4]) III. |
GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170. |
| OH19205 |
golg-4(ot1509[mScarlet3::golg-4]) III. |
mScarlet3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170. |
| OH19206 |
golg-4(ot1510[mScarlet-I3::golg-4]) III. |
mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170. |
| OH19124 |
pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. |
SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| OH19125 |
pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. |
GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| OH19299 |
unc-75(ot1539[mScarlet-I3::unc-75]) I. |
mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
| PHX7515 |
dve-1(syb7515[dve-1::AID*::mScarlet]) X. |
AID*::mScarlet tag inserted into endogenous dve-1 locus via CRISPR/Cas9 engineering. Reference: Alexander, K.D. et al. Nat Commun 2023 Nov 18;14(1):7520. PMID: 37980357. |
| RJP3221 |
rpIs109. |
rpIs109 [dpy-7p::NLS::dsRed2 + rol-6(su1006)]. Nuclear red fluorescence in hypodermal cells. Reference: Romanos TR, et al. Sci Rep. 2017 Aug 4;7(1):7294. doi: 10.1038/s41598-017-07876-4. PMID: 28779171. |
| PHX6949 |
ifet-1(syb6949[ifet-1(del NLS)::mMaple *dfw15]) III. |
Deletion of the Nuclear Localization Sequence (NLS; 220-235aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. No embryonic viability defect in hermaphrodites. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896. |
| PY12001 |
osm-3(oy156) IV. |
Temperature-sensitive allele of osm-3. Restrictive temperature 30C. Can be maintained at 20C. Reference: Philbrook A, et al. PLoS Biol. 2024 Nov 26;22(11):e3002892. doi: 10.1371/journal.pbio.3002892. PMID: 39591402. |
| AV1443 |
dao-5(ok542)/tmC18[dpy-5(tmIs1200)] I. |
Heterozygotes are wild type with a green pharynx. They segregate Dpy, green pharynx, tmC18 homozygotes, and sterile, non-green pharynx, dao-5 homozygotes. |
| EU3501 |
apx-1(or2015) V/nT1 [unc-?(n754) let-?] (IV;V). |
Heterozygous. Pick Unc to maintain. Heterozygotes are Unc and segregate Unc heterozygotes, wildtype (or2015 homozygotes that give only dead progeny), and and arrested nT1 aneuploids. Pick Unc and check for correct segregation of progeny to maintain. or2015 is a CRISPR/Cas9-engineered null allele removing the entire apx-1 open reading frame. Reference: Chuang CH, et al. G3 (Bethesda). 2025 Sep 26:jkaf229. doi: 10.1093/g3journal/jkaf229. PMID: 41004705. |
| EU1013 |
apx-1(or545) V. |
Temperature-sensitive. Maintain at 15C. or545 homozygotes produce 99.9% dead embryos at 26C. or545 is a G138R mutation in the DSL repeat. Reference: Chuang CH, et al. G3 (Bethesda). 2025 Sep 26:jkaf229. doi: 10.1093/g3journal/jkaf229. PMID: 41004705. |
