| BC12994 |
C. elegans |
dpy-5(e907) I; sIs12736. Show Description
sIs12736 [rCesC35B1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| VH7046 |
C. elegans |
ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGAGTTAGGTTATCAATATGACGACGCCC; Right flanking sequence: TGGAAATTGAAGAAATTGCTGCTCCAGGAG. sgRNA #1: CTCATCAAACGTCTACGGCT; sgRNA #2: CGCAGTGCTCAAGGATGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| DLM15 |
C. elegans |
ubc-18(tm5426) III. Show Description
|
|
| DLM16 |
C. elegans |
ubc-18(tm5426) sup-35(e2215) pha-1(e2123) III. Show Description
sup-35 rescues synthetic lethality of ubc-18 and pha-1.
|
|
| DLM18 |
C. elegans |
ubc-18(tm5426) III; sup-36(e2217) IV. Show Description
sup-36 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.
|
|
| DLM19 |
C. elegans |
ubc-18(tm5426) III; sup-37(e2215) V. Show Description
DLM 19: sup-37 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.
|
|
| DLM21 |
C. elegans |
unc-119(ed3)III; uwaEx4. Show Description
uwaEx4 [ubc-18::GFP::HA + myo-3p::RFP + unc-119(+)]. Pick RFP+ animals to maintain. Translational GFP transgene rescues ubc-18(tm5426).
|
|
| FX30218 |
C. elegans |
tmC30 [ubc-17(tmIs1247)] X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::Venus. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30236 |
C. elegans |
tmC30 [ubc-17(tmIs1243)] X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::mCherry. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| PS7898 |
C. elegans |
C53C9.2(sy1116 sy1118)/tmC30 [ubc-17(tmIs1243)] X. Show Description
Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS7911 |
C. elegans |
C53C9.2(sy1122)/tmC30[ubc-17(tmIs1243)] X. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2.
lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG;
right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda).
|
|
| RB2341 |
C. elegans |
ubc-16(ok3177) I. Show Description
Y54E5B.4. Homozygous. Outer Left Sequence: AAGTTGTCGGAATTGGTTGG. Outer Right Sequence: TTGCGATTCGAAGAGAGCTT. Inner Left Sequence: CATTGTTCAATATGCACCCAA. Inner Right Sequence: TGGCCACAAAGAAGAAAAGG. Inner Primer PCR Length: 1138 bp. Deletion Size: 551 bp. Deletion left flank: TAAACACAATTTTTTTTCAGACGACAGTGT. Deletion right flank: GTGGGCGGCAAACGATTTTCCCGGAAAAAC. Insertion Sequence: ACAGTACCCACATTTGATAATATTTCGATACAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RG3048 |
C. elegans |
M03F4.6(ve548[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30[ubc-17(tmIs1243)] X. Show Description
tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous lethal. Deletion of 2153 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, arrested GFP+ non-mCherry (ve548 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TTTGACTTGTTTGTACCCGCATCTACATTG ; Right flanking sequence: ATCGGGAGTTTCTGCACACTGAGTTCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3308 |
C. elegans |
C15H9.4(ve808[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30 [ubc-17(tmIs1243)] X. Show Description
tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous animals may be sensitive to starvation (grotty, low brood size). Deletion of 1634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, wild-type GFP+ non-mCherry (ve808 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TACTATATTCTGTTATTCCAAAATGCGTTT ; Right flanking sequence: ATAATGTGAACAGCACGCAAAACGGAACAA. sgRNA #1: GTTCCAGATGACAACAGACT; sgRNA #2: TGTCAAATCAGCTTTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC2144 |
C. elegans |
T24F1.2(gk3219) II; T26A8.4(gk3176) IV; ubc-17(gk3220) X. Show Description
This strain is homozygous for a deletion (gk3176) in T26A8.4, detectable by PCR using the following primers. External left primer: TGCTTTGGCTCTTCTTGGAT. External right primer: TGTTTGCGCTGAGAGAGAGA. Internal left primer: GCTGAACTAATCCAGGCTGC. Internal right primer: TCCAACGTTCAAGATTCCAA. Internal WT amplicon: 1977 bp. Deletion size: approximately 625 bp. Validation: gk3176 passed by CGH. Left deleted probe: TTGCGGTGGCTGAACTAATCCAGGCTGCTGAAGATGTGGATGTTGAATTG. Right deleted probe: AAACTAACCTTTTTACAAAAACTATTAGCATAAAAGTTGCACAGAACAGG. Other deletions (gk3219, gk3220) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2389 |
C. elegans |
ubc-16(ok3176) I. Show Description
Y54E5B.4. External left primer: AAGTTGTCGGAATTGGTTGG. External right primer: TTGCGATTCGAAGAGAGCTT. Internal left primer: CATTGTTCAATATGCACCCAA. Internal right primer: TGGCCACAAAGAAGAAAAGG. Internal WT amplicon: 1138 bp. Deletion size: 684 bp. Deletion left flank: AATTGATGACGCTATTTATGTGAGAACGTG. Deletion right flank: AACGGCACACTGCCGGAATTAAAATTTCCG. Insertion Sequence: TGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| WY34 |
C. elegans |
ubc-18(ku354) III. Show Description
Synthetic with lin-35. Slightly reduced growth rate. Reduced brood size. Otherwise appears wild-type.
|
|