| SSM476 |
C. elegans |
rpa-1(iow92[OLLAS::rpa-1]) II. Show Description
N-terminal OLLAS tag inserted into the endogenous rpa-1 locus using Crispr/Cas9. Generated in N2 background. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.
|
|
| BC14224 |
C. elegans |
dpy-5(e907) I; sEx14224. Show Description
sEx14224 [rCesF18A1.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| SSM473 |
C. elegans |
rpa-1(iow89[GFP11::rpa-1]) II; iowSi8 II; unc-119(ed3) III. Show Description
rpa-1(iow89[GFP11::rpa-1]) II. iowSi8 [pie-1p::GFP1-10::him-3 3UTR + Cbr-unc119(+)] II. CRISPR/Cas9 insertion of GFP11 tag into endogenous rpa-1 locus in background strain SSM471. GFP::RPA-1 fluorescence only observed in the germline. If germline silencing occurs, transgene expression can be recovered by growing worms at 25C for 2 generations. Reference: Hefel A & Smolikove S. G3. 2019 Jun 5;9(6):1933-1943. PMID: 30992318.
|
|
| SSM559 |
C. elegans |
rpa-4(iow128[Myc::rpa-4]) rpa-2(iow49[3xFLAG::rpa-2]) I; rpa-1(iow92[OLLAS::rpa-1]) II. Show Description
CRISPR/Cas9 engineering used to insert N-terminal Myc tag into the endogenous rpa-4 locus, N-terminal 3xFLAG tag into the endogenous rpa-2 locus, and N-terminal OLLAS tag into the endogenous rpa-1 locus. SSM559 was generated by crossing rpa-2(iow49) with rpa-1(iow92), followed by CRISPR insertion of the Myc tag into rpa-4. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.
|
|
| SSM596 |
C. elegans |
rpa-1(iow117)/mIn1[mIs14 dpy-10(e128)] II. Show Description
Crispr/Cas9-engineered indel in the 5 region of rpa-1. Larval-lethal mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP iow117 homozygotes (larval lethal). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. iow117 was generated in mre-11::GFP background and outcrossed to N2. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.
|
|
| GW1599 |
C. elegans |
met-2(n4256) set-25(n5021) III; opIs263. Show Description
opIs263 [rpa-1p::rpa-1::YFP + unc-119(+)]. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Express RPA-1::YFP in both germline and somatic tissues. Reference: Padeken J, et al. Genes Dev. 2019 Apr 1;33(7-8):436-451. PMID: 30804228
|
|
| RG3106 |
C. elegans |
rpa-1(ve606[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 2554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve606 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttctacgccattttttttggcgcgtatccg ; Right flanking sequence: atccacaatcgctgattttgtacaatgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| GLW91 |
C. elegans |
hrpa-1(utx71[hrpa-1::mScarlet-I-C1::3xMyc]) IV. Show Description
C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd 5 GTCTCCACCAAACGCCTGTA 3 ; rev 5 CTAGCCTGTGTCCCATCAGC 3. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.
|
|
| RB1052 |
C. elegans |
trpa-1(ok999) IV. Show Description
C29E6.2. Homozygous. Outer Left Sequence: TCGGCTCTCTTTTCCTGTGT. Outer Right Sequence: GGTACACCGAAGTGCCATCT. Inner Left Sequence: GCTGGAATTGGAAGGATTGA. Inner Right Sequence: TCGTGACACTACCATTCCCA. Inner Primer WT PCR Product: 3280. Deletion size: 1334 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| TG2368 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs2368. Show Description
gtIs2368 [pie-1p::GFP(lap)::rpa-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TQ233 |
C. elegans |
trpa-1(ok999) IV. Show Description
Shorter lifespan than wild-type worms at 15-20 C, but not at 25 C. Reference: Xiao R, et al. Cell. 2013 Feb 14;152(4):806-17.
|
|
| VC406 |
C. elegans |
hrpa-1(ok592) IV/nT1 [qIs51] (IV;V). Show Description
F42A6.7. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok592 homozygotes (extremely slow-growing, nearly sterile, often with vulval blip). Homozygous nT1[qIs51] inviable. Pick WT GFP hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC659 |
C. elegans |
hrpa-1(ok963) IV/nT1 [qIs51] (IV;V). Show Description
F42A6.7. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok963 homozygotes (slow-growing with body morphology defects, small broods). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| WS4581 |
C. elegans |
unc-119(ed3) III; opIs263. Show Description
opIs263 [rpa-1p::rpa-1::YFP + unc-119(+)]. YFP expression in soma and germline.
|
|