| CHS1157 |
C. elegans |
npr-1(yum1928) npr-2(yum1929) npr-3(yum1930) npr-4(yum1931) npr-5(yum1932) npr-10(yum1933) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1069 |
C. elegans |
npr-31(yum1446) II; npr-32(yum1447) IV; npr-33(yum1448) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1079 |
C. elegans |
npr-34(yum1491) II; npr-35(yum1492) npr-22(yum1489) IV; npr-24(yum1490) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1080 |
C. elegans |
npr-29(yum1494) npr-30(yum1495) III; npr-28(yum1493) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1120 |
C. elegans |
fshr-1(yum1706) V; npr-42(yum1703) II; npr-36(yum1704) pcdr-1(yum1707) X; tag-89(yum1705) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| OH17294 |
C. elegans |
npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| PHX4433 |
C. elegans |
npr-32 (syb4433 [npr-32::SL2::GFP::H2B] IV. Show Description
GFP tag inserted at the C-terminus of the endogenous npr-32 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX4440 |
C. elegans |
npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous npr-37 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
|
|
| PS8317 |
C. elegans |
npr-33(sy1272) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-33. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAACGAGCACATTGATAAGTGTACTGGCCACCC right flanking sequence: AATCAGCTCCGCTTCAATGCTTTTCCTGTCATCCG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAAGCGGAGCTGATTGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8484 |
C. elegans |
npr-31(sy1360) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-31. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaaaaactagttataaaaatgttcagATCCCTTA right flanking sequence: TGTCCAGAAGCTCCCCTTCAGATCGATTACGTGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGGGAGCTTCTGGACATAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| RG3192 |
C. elegans |
npr-33(ve692[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 3243 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTAATGGACCGAAAGCTGATGAGCTCCT ; Right flanking sequence: tggtcataaatttttgttgtatttttatat. sgRNA #1: CAGGAGAAACTGGTTAACTG; sgRNA #2: TCTTTCAACGCTTCTATGAa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|