More Fields
Strain Species Genotype
KRA597 C. elegans pha-1(e2123) III; kasEx286. Show Description
kasEx286 [npr-29::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with npr-29 genomic region (-9,810 to -6,028 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
PS8315 C. elegans npr-29(sy1270) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-29. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaATGGACTTTACGGAAAATGAAGAGGAGTACGAG right flanking sequence: CATTGGACACATATTGAACGACGAGTCCCGTTTC Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGAAGAGGAGTACGAGCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616