More Fields
Strain Species Genotype
RG3192 C. elegans npr-33(ve692[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 3243 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTAATGGACCGAAAGCTGATGAGCTCCT ; Right flanking sequence: tggtcataaatttttgttgtatttttatat. sgRNA #1: CAGGAGAAACTGGTTAACTG; sgRNA #2: TCTTTCAACGCTTCTATGAa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
PS8317 C. elegans npr-33(sy1272) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-33. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAACGAGCACATTGATAAGTGTACTGGCCACCC right flanking sequence: AATCAGCTCCGCTTCAATGCTTTTCCTGTCATCCG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAAGCGGAGCTGATTGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616