Search Strains

More Fields
Strain Species Genotype Add
ABR14 C. elegans shEx34. Show Description
shEx34 [myo-3p::mCherry]. Pick mCherry+ to maintain. This strain serves as a control strain to ABR16. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.
ABR16 C. elegans shEx1. Show Description
shEx1 [ges-1p::fat-7 + myo-3p::mCherry]. Pick mCherry+ to maintain. FAT-7 over-expressing strain. ABR14 serves as a control strain for this strain. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.
AD238 C. elegans asIs2. Show Description
asIs2 [pie-1p::mCherry::egg-3].
AMH11 C. elegans wpIs36 I; sosIs5. Show Description
wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)].
AMH13 C. elegans wpIs36 I; unc-33(e204) IV; sosIs5. Show Description
wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc.
AMH23 C. elegans wpIs36 I; unc-33(e1193) IV; sosIs5. Show Description
wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc; almost paralyzed. Growth slow.
AMH57 C. elegans unc-33(mn407); olaEx3013. Show Description
olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144
AMH59 C. elegans unc-33(e204); olaEx3013. Show Description
olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Paralyzed Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144
AMH91 C. elegans unc-104(e1265) II; olaEx3013. Show Description
olaEx3013 [ttx-3p::mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Slow moving. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144
AML1 C. elegans zfIs18; zfIs42. Show Description
zfIs18 [mec-4p::ChR2::YFP]. zfIs42 [rig-3p::GCaMP3::SL2::mCherry]. Pick mCherry+ animals to maintain strong expression from zfIs42. Worm expresses light-sensitive Channelrhodopsin (ChR2) and yellow fluorescent protein (YFP) in mechanosensory neurons, ALMR/L, AVM, PLML/R, and PVM. When fed all-trans retinal, blue light stimulation (473 nm at 2 mW * mm^-2) of head induces reversals. GCaMP3 and and mCherry expression in command interneurons AVA, and nearby pharyngeal neurons I1, I4, M4, NSM. Worms were made by crossing the integrated strains QW309 and QW625. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
AML105 C. elegans wtfIs32. Show Description
wtfIs32 [str-2p::ChR2(H134R)::GFP +, myo-3p:mCherry]. Expression of an activating opsin molecule ChR2 (H134R) in AWC-ON neuron and mCherry in body wall muscles. Reference: Chen KS, et al. Olfactory learning alters navigation strategies and behavioral variability in C. elegans. ArXiv, Feb 23:arXiv:2311.07117v2. PMID: 38013890.
AML17 C. elegans wtfIs2. Show Description
wtfIs2 [rig-3p::Chrimson::SL2::mCherry]. Transgenic animals express light-gated ion channel Chrimson and fluorescent protein mCherry in AVA neurons as well as nearby pharyngeal neurons I1, I4, M4, NSM. Worms reverse more upon exposure to red light via optogenetic activation of AVA neurons. Reference: Kumar S, et al. PLoS Biol. 2023 Sep 21;21(9):e3002280. doi: 10.1371/journal.pbio.3002280. PMID: 37733772.
AML470 C. elegans juSi164 unc-119(ed3) III; wtfIs458. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs458 [mec-4::Chrimson4.2::SL2::mCherry::unc-54 3' UTR + unc-122::GFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Transgenic animals express light-gated ion channel Chrimson and a fluorescent protein mCherry in mechanosensory neurons alongside GFP in coelomocytes. Reference: Liu M, et al. PLoS Biol. 2022 Jan 28;20(1):e3001524. doi: 10.1371/journal.pbio.3001524. PMID: 35089912.
AML499 C.elegans wtfIs46; wtfIs465. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfIs465 [lim-4p::gtACR2::SL2::eGFP::unc-54 3' UTR + unc-122::RFP]. Transgenic animals express light-gated ion channel Chrimson and mCherry in mechanosensory neurons, and light-gated ion channel gtACR2 and eGFP in turning associated neurons RIV, SMB and SAA. RFP expression in coelomocytes. Reference: Kumar S, et al. PLoS Biol. 2023 Sep 21;21(9):e3002280. doi: 10.1371/journal.pbio.3002280. PMID: 37733772.
AML580 C. elegans wtfIs491. Show Description
wtfIs491 [inx-1p::twk-18(gf)::mCherry + unc-122p::RFP]. AIB(-) activated potassium channel. Expression of twk-18 gain-of-function mutant in AIB neurons causes permanent inhibition. RFP expression in coelomocytes. Reference: Chen KS, et al. Olfactory learning alters navigation strategies and behavioral variability in C. elegans. ArXiv, Feb 23:arXiv:2311.07117v2. PMID: 38013890.
AML597 C. elegans lgc-47(sy1501) X; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML614 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx535. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx535 [tdc-1p::AI::lgc- 47::SL2::his-24::tagRFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in RIML/R neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML617 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx538. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx538 [npr-9p::AI::lgc-47::SL2::tagBFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML618 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx539. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx539 [rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AVA neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML622 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx543. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx543 [tdc-1p::AI::lgc-47::SL2::his-24::tagRFP + npr-9p::AI::lgc-47::SL2::tagBFP + rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB, AVA, and RIM neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML627 C. elegans acc-1 (tm3268) IV; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML659 C. elegans acc-1(tm3268) IV; lgc-47(sy1501) X; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. mec-4 promoter drives expression of activating opsin molecule Chrimson and fluorescent protein mCherry in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. (2024) iScience. https://www.sciencedirect.com/science/article/pii/S2589004224020017 PMID: 38585821.
AML67 C. elegans wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Transgenic animals express light-gated ion channel Chrimson and mCherry in mechanosensory neurons. Reference: Liu M, et al. eLife 2018;7:e36419 DOI: 10.7554/eLife.36419.
AMP101 C. elegans weSi174 II; daf-2(syb1177[daf-2::AID*::TEV::3xFLAG]) III. Show Description
weSi174 [eif-3.Bp::TIR1::linker::mCherry(dpiRNA)::tbb-2 3'UTR + unc-119(+)] II. Auxin-inducible degradation of DAF-2::AID* causes dauer formation. Reference: Eder M, et al. Cell. 2024 Jul 25;187(15):3919-3935.e19. doi: 10.1016/j.cell.2024.05.050. PMID: 38908368.
AMP116 C. elegans weSi174 II; daf-2(syb1177[daf-2::AID*::TEV::3xFLAG]) glp-1(e2141) III. Show Description
weSi174 [eif-3.Bp::TIR1::linker::mCherry(dpiRNA)::tbb-2 3'UTR + unc-119(+)] II. Maintain at 20C or less. Sterile at 25C. Auxin-inducible degradation of DAF-2::AID* causes dauer formation. Reference: Eder M, et al. Cell. 2024 Jul 25;187(15):3919-3935.e19. doi: 10.1016/j.cell.2024.05.050. PMID: 38908368.
ANA72 C. elegans adeIs1 II; unc-119(ed3) III; ltIs37 IV. Show Description
adeIs1 [mex-5::spd-1::GFP + unc-119(+)] II. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Superficially wild-type. SPD-1::GFP and mCherry-tagged histones allow visualisation of chromatin with central spindle/midbody during cell divisions. Reference: Nahaboo W, et al. Mol Biol Cell. 2015 Jun 1;26(11):2020-9.
AU133 C. elegans agIs17 IV. Show Description
agIs17 [myo-2p::mCherry + irg-1p::GFP] IV. GFP in pharynx and intestine that turns on upon infection with pathogenic Pseudomonas aeruginosa strain PA14. Reference: Dunbar TL, et al. Cell Host Microbe. 2012 Apr 19;11(4):375-86.
AUM1695 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I. Show Description
V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1747 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz146[PAZ deletion]) I. Show Description
282bp deletion (247aa-345aa) in PAZ domain of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1760 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz151[D583A]) I. Show Description
Inactive RNase mutation of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1880 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AVS397 C elegans gpIs1; artEx35. Show Description
gpIs1 [hsp-16.2p::GFP]. artEx35 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick animals with red pharynx to maintain. Inducible GFP fluorescence after >1 hour heat shock. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AVS408 C. elegans artEx31. Show Description
artEx31 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick mCherry+ animals to maintain. sur-5 driven over-expression of hpk-1. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AX1789 C. elegans dbEx719. Show Description
dbEx719 [npr-5::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in a subset of amphid neurons (ADF, ASE, ASG, ASI, ASJ, ASK, AWA, AWB), in the inner labial neuron IL2, in the interneurons AIA and AUA, and in the phasmids (PHA, PHB). Expression was also seen in head, neck, and body wall muscles. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AX1792 C. elegans dbEx721. Show Description
dbEx721 [npr-4::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in the AVA and RIV neurons, possibly in BAG, in the tail neuron PQR, and in the BDU neurons. Expression was also seen in the coelomocytes, the intestine, and the rectal gland cells. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AY156 C. elegans acIs156. Show Description
acIs156 [vit-2p::vit-2(G839R)::GFP + myo-2p::mCherry]. In contrast to VIT-2::GFP, VIT-2(G839R)::GFP remains in the intestine and is not transported to embryos. mCherry expression in pharynx. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY162 C. elegans mul-1(syb1027) IV; acEx162. Show Description
acEx162 [mul-1p::mul-1::SL2::GFP + myo-2p::mCherry]. Pick mCherry+ to maintain. GFP expression in the intestine. acEx162 transgene rescues mul-1(lf). mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9 ?1,650-bp deletion mutant of isoforms A and B (565?bp and 952?bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
AY188 C elegans unc-30(ok613) IV; acEx188. Show Description
acEx188 [unc-30(+) + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by its own promoter rescues unc-30(ok613). Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721.
AY189 C. elegans unc-30(ok613) IV; acEx189. Show Description
acEx189 [rab-3p::unc-30 + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by rab-3 neuronal promoter rescues unc-30(ok613) in neurons. Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721.
AY190 C. elegans acEx190. Show Description
acEx190 [tax-2p::CZ::ced-3(p17)::unc-54 3’UTR + lim-6p::ced-3(p15)::NZ::unc-54 3’UTR + myo-3p::mCherry]. Pick mCherry+ to maintain.  ASG is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the tax-2 and lim-6 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721.
BB92 C. elegans dcr-1(ok247) III; uuEx18. Show Description
uuEx18 [dcr-1(wild-type) + dpy-30::mCherry]. Superficially wild-type. Reference: Welker N, et al. (2010) RNA 16:893-903.
BB93 C. elegans dcr-1(ok247) III; uuEx19. Show Description
uuEx19 [dcr-1(K39A) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.
BB94 C. elegans dcr-1(ok247) III; uuEx20. Show Description
uuEx20 [dcr-1(D145N) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.
BB95 C. elegans dcr-1(ok247) III; uuEx21. Show Description
uuEx21 [dcr-1(G492R) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.
BK201 C. elegans qpIs95 X. Show Description
qpIs95 [exc-9p::mCherry::eea-1] X. Expression of mCherry-tagged EEA-1 of early endosomes in cytoplasm of excretory canals along nearly entire length of worm. Fluorescence not strong. Generated in N2 background. Construct integrated on X chromosome. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
BK204 C. elegans qpIs96. Show Description
qpIs96 [exc-9p::mCherry::cdc-42]. Expression of mCherry-tagged cytoplasmic CDC-42. Generated in N2 background. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
BK205 C. elegans qpIs97 V. Show Description
qpIs97 [exc-9p::mCherry::rab-11] V. Expression of mCherry-tagged RAB-11 of recycling endosomes in cytoplasm of excretory canals along nearly entire length of worm. Generated in N2 background. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
BK206 C. elegans qpIs98. Show Description
qpIs98 [exc-9p::mCherry::glo-1]. Expression of mCherry-tagged GLO-1 of lysosomes in cytoplasm of excretory canals along nearly entire length of worm. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
BK210 C. elegans qpIs100. Show Description
qpIs100 [exc-9p::mCherry::rab-7]. Expression of mCherry-tagged RAB-7 of late endosomes in cytoplasm of excretory canals along nearly entire length of worm. Generated in N2 background. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
BK211 C. elegans qpIs101 X. Show Description
qpIs101 [exc-9p::mCherry::rme-1] X. N2 containing construct conferring expression of mCherry-tagged RME-1 of recycling endosomes in cytoplasm of excretory canals along nearly entire length of worm. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.