Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC109 C. elegans apc-11(gk37)/eT1 III; +/eT1 V. Show Description
F35G12.9. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and sterile homozygous gk37 hermaphrodites. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
AGK370 C. elegans zfp-1(ok554) III; armIs9. Show Description
armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
CB7468 C. elegans acs-22(gk373989) X. Show Description
No obvious phenotype; derived from VC20689. Reference: O'Rourke et al (in preparation).
TP91 C. elegans pdi-2(gk375)/lon-2(e678) X. Show Description
Maintain at 15 degrees. Heterozygotes are WT and segregate WT , Longs, and strong Dpys which are Sterile.
VC3709 C. elegans pry-1(gk3681[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I; F56E10.1(gk3701) V. Show Description
Homozygous viable. Primary deletion of 720 bp in pry-1 with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAGGGGCCCCTCCCGGTAGCCGGTCGAGCG; Right flanking sequence: GGATTTTTCTGCGAAATTTGGATTTAGCTT. Strain carries secondary 5-bp deletion in F56E10.1, with flanking sequences GGCGCCGGCGGTGAAGAGGATGAGGACAAT and GGATTCAGAAGAAGAAGATGAAGAAGACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3742 C. elegans C52B11.5(gk3700[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATTTGGACAACGCTCTGTGCACAAATCA; Right flanking sequence: TGGCTTAACGAATGAAGATAATGGATTCAA. See WormBase Variation gk3700 for details.
VC3744 C. elegans R08A2.2(gk3702[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 956 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCATCTTCAGCTAGCAGCTTCTTCGGAGG. Right flanking sequence: CGGATGCATTCAATGACAAGCAGATTTACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3745 C. elegans flp-9(gk3703[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 272 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTCAGACTCCGCCCATACGTGTGCTCTCCA; Right flanking sequence: AGGTTCAACTTTTTCGAAAAACGAACAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3747 C. elegans W04C9.5(gk3705[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 855 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCCACATGGTGACCTAGGTTTACAGGTGGT; Right flanking sequence: AGGTATGCAACAACGCTCCATTGCTAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3749 C. elegans lgc-17(gk3707[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGAAAAATTAAAGGAAATTGAACAGTAAG. Right flanking sequence: TGGAGGTGCAAGAGCCAGAAGAAAAAGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3750 C. elegans lgc-45(gk3708[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 761 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAGGACCAATGGATCTACGAAGTAAGTTG. Right flanking sequence: CGGCGAAAAGACGCCATCGACAAAAATCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3751 C. elegans lgc-10(gk3709[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTTCTTCCGCGTTTTCTAACCACTTTCC. Right flanking sequence: AGGTCAACGAGAAGTTATTGTTCCACAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3763 C. elegans EEED8.12(gk3721[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 264 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAATTGTAGAGTTAAAATCTACATTTCCA; Right flanking sequence: CAGAAGGGAAACCATAAATAACGATGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3764 C. elegans rsp-4(gk3722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 404 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCGCGTTTCTGTTAGCTATATTCAATTC; Right flanking sequence: TGGTGGTGGACGTAGAAGGTTAGTATACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3766 C. elegans kin-24(gk3724[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 978 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAACATCACCGACTCGCGTGCAAAATCCG; Right flanking sequence: GGTTCCAGCAATGCAGGCTGTTCTCAGTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3769 C. elegans lgc-31(gk3727[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 634 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATGATTATCTGGATCCACCGTTATTTTGGG; Right flanking sequence: AGGTGAGTCGGGTGGAACCTCGAACACGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3771 C. elegans lgc-15(gk3728[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 877 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACAACTGTAACTCTGAAACTATTGAAGC. Right flanking sequence: TGGACACGATCCAGACGCCCCGGGACGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3773 C. elegans sup-46(gk3730[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 581 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGCTTAATCCAAGATCCGTGTTCCATCAGC. Right flanking sequence: AGGTGGTGGTGCAGGAGGACGAGGTCCTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3784 C. elegans C50D2.5(gk3741[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 425 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTCCCTGTGGAATTTCGGAGTGTCGTTGGC; Right flanking sequence: TGGTGCTCTATTATCAAGCGACAAAAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3787 C. elegans ZK673.2(gk3749) II; gop-1(gk3747) III. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing.
VC3788 C. elegans ZK673.2(gk3749) II; lipl-5(gk3748) V. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing.
VC3790 C. elegans F47D12.6(gk3750) III; ptr-16(gk3752) V; M163.11(gk3751) X. Show Description
Homozygous viable. Nonsense alleles and splicing defect allele identified by amplicon sequencing.
VC3792 C. elegans sop-3(gk3753) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC3800 C. elegans T22C1.1(gk3772[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1764 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGCGCGAGGATGATTTGAAACTGGCGCCC. Right flanking sequence: TGGAAGAACAATTGCTGCTTCTGACATTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3801 C. elegans pqn-82(gk3768[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 886 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTACAGAAGTTTTAAGAAAACTGGGTCAAG; Right flanking sequence: AGGAGCAATTGGCTCAGCAGCATCACCAGC. See WormBase Variation gk3768 for details.
VC3802 C. elegans F11A10.7(gk3769[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 857 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGATCAGCCGTACTATTGATACTCTATG; Right flanking sequence: TGGACGATCATGTGATTCGTGTTGACAAAG. See WormBase Variation gk3769 for details.
VC3804 C. elegans C25E10.12(gk3771[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 273 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGATGAACGCTTACAGAGAAACGGATATC; Right flanking sequence: AAGAAATATGTGAAACAAGGACGAGTTTGT. See WormBase Variation gk3771 for details.
VC3810 C. elegans EEED8.4(gk3778[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 331 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATCATTTAGTATTCTATGAGTTGGTCCTC; Right flanking sequence: AGGATGTGGACAGATTGTGAAAACTACAAT. See WormBase Variation gk3778 for details.
VC3824 C. elegans sel-11(gk3792[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2037 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTGGCTCGTGTGTGGCGACTGCGGCCA; Right flanking sequence: CGGACCGTCAACAGATCAAGTCACTTCGGA. See WormBase Variation gk3792 for details.
VC3831 C. elegans C15A7.2(gk3798[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGTCACAATGTTATCCACAATGTTCACCA; Right flanking sequence: CAAAATATAGAAGGAGCATTTGAGTTGGGT. See WormBase Variation gk3798 for details.
VC3832 C. elegans ubc-6(gk3799[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 861 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CATGCACAACCAATGGAAGACAATCTTTTT; Right flanking sequence: TGGTATTCCAACACCACGCTCCCCGCTTGG. See WormBase Variation gk3799 for details.
VC3875 C. elegans clc-1(gk3754) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC3876 C. elegans C33F10.8(gk3755) II; F28C1.1(gk3756) V. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing.
VC3877 C. elegans F28C6.4(gk3758) F13D12.3(gk3757) II; Y55F3AM.9(gk3760) M7.8(gk3759) IV. Show Description
Homozygous viable. Nonsense alleles and splicing defect identified by amplicon sequencing.
VC3878 C. elegans F58H1.6(gk3761) V. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC3879 C. elegans pyk-1(gk3762) I; Y38H8A.12(gk3763) IV; ZC8.6(gk3764) X. Show Description
Homozygous viable. Splicing defects identified by amplicon sequencing.
VC3880 C. elegans C51E3.9(gk3766) C27A7.9(gk3765) V. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
VC3881 C. elegans str-211(gk3767) I. Show Description
Homozygous viable. Splicing defect identified by amplicon sequencing.
VC858 C. elegans +/szT1 [lon-2(e678)] I; pdi-2(gk375)/szT1 X. Show Description
C07A12.4a. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk375 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC878 C. elegans spp-10(gk373) IV. Show Description
C28C12.7a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC879 C. elegans gly-7(gk374) V. Show Description
Y46H3A.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC881 C. elegans pcp-5(gk377) III. Show Description
ZK688.6a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC883 C. elegans tag-273(gk371) IV. Show Description
Y57G11A.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC884 C. elegans rig-6(gk376) II. Show Description
C33F10.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC889 C. elegans wwp-1(gk372) I. Show Description
Y65B4BR.4a. gk372 is a 1509 bp deletion with a 146 bp insertion. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC893 C. elegans atg-18(gk378) V. Show Description
F41E6.13a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC924 C. elegans dcp-66(gk370) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C26C6.5a. Homozygous sterile deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk370 homozygotes (scrawny, Unc sterile, often with protruding vulva; distintegrates in early adulthood). Homozygous hT2[qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC925 C. elegans coq-5&ufm-1(gk379) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK652.3, ZK652.9. Homozygous lethal deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk379 homozygotes (probable early larval arrest). Homozygous hT2[qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
YQ243 C. elegans unc-119(ed3) III; atg-18(gk378) V; wfIs232. Show Description
wfIs232 [app-1p::mCherry::H2B::unc-54 + unc-119(+)]. mCherry::H2B expression in the nuclei of intestinal cells. YQ243 can serve as a control strain for YQ95. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.
YQ95 C. elegans unc-119(ed3) III; atg-18(gk378) V; wfIs120. Show Description
wfIs120 [app-1p::atg-18::unc-54 + unc-119(+)]. Intestine-specific promoter app-1 drives atg-18 expression in the atg-18(gk378) mutant background, providing rescue in intestinal cells. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.