Search Strains

av144 is a CRISPR/Cas9 engineered deletion in the N-terminal region of pezo-1 removing exons 1–13. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.

av149 is a CRISPR/Cas9 engineered deletion in the C-terminal region of pezo-1 removing the last seven exons (27–33) and introns. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.

Deletion allele which removes exons 2 to 6 of lip-1 (C05B10.1). Incompletely penetrant ovulation defect.

EMS-induced deletion from -583 to +1017, including first two exons and part of third exon. Probable null. No obvious phenotype.

Viable, Bus, resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation).

Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2737 is a ~4.5 kb deficiency which removes all of the bus-10 exons, internal ncRNA genes ZK596.4 & ZK596.5, and ZK596.1. Reference: O'Rourke et al (in preparation).

Bus, bleach-sensitive, resistant to Leucobacter Verde2 and Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation).

eEx763 [bus-8(exonU2stop) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal bus-8 mutation rescued by bus-8 transgene defective in 5' exons U1 and U2. Reference: Stroud et al (in preparation).

twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. Superficially wild-type. Normal dauer formation. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

twnEx656 [pmp-4p::pmp-4 + elt-2p::GFP]. Pick GFP+ animals to maintain. Superficially wild-type. twnEx656 contains 1.2 kb pmp-4 promoter driving expression of 2.2 kb pmp-4 cDNA; transgene rescues behavioral phenotype of twn16 mutants. twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. twn16 has been out-crossed 3 times in this strain. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

mgEx470 [pdk-1(+) + ttx-3::GFP]. Pick GFP+ to maintain. 9.2-kb PCR product of genomic DNA from the pdk-1(+) genomic region containing 2.7 kb of 5' upstream regulatory sequence, 6.1 kb of coding sequencing containing introns and exons, and 0.4 kb of pdk-1 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.

mgEx340 [akt-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-1::GFP translational fusion containing 6.7 kb akt-1 genomic DNA including 3.2 kb of 5' upstream regulatory region and 3.5 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.

mgEx341 [akt-2::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-2::GFP translational fusion containing 5.2 kb akt-1 genomic DNA including 2.1 kb of 5' upstream regulatory region and 3.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.

mgEx481 [pdk-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. PDK-1::GFP translational fusion containing 9 kb akt-1 genomic DNA including 2.9 kb of 5' upstream regulatory region and 6.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.

mgEx579 [ins-18p::GFP + rol-6(su1006)]. Pick Rollers to maintain. ins-18::GFP promoter fusion containing 4.9 kb upstream regulatory sequence and 2.1 kb of coding region (including exons and introns) driving GFP expression with 0.8 kb downstream sequence. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.

Null allele. CRISPR-engineered deletion of the tdp-1 locus precisely eliminates all known tdp-1 exons and introns. Reference: Lins J, et al. Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants. MicroPubl Biol. 2023 Jun 6;2023:10.17912/micropub.biology.000693. doi: 10.17912/micropub.biology.000693. PMID: 37351305.

Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC.

Dyf. Osm. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).

No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).

C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).

Heterozygotes are WT and segregate WT, Paralyzed Uncs and L3 lethals. ua1 is a deletion of the first 3 full exons of the NADH-ubiquinone oxidoreductase of complex I in the mitochondrial respiratory chain.

Animals with the duplication are WT. Animals which have lost the duplication arrest at 3rd larval stage with increased life span. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

Heterozygotes are WT and segregate WT, Dpy(ts) Steriles and Uncs which arrest in the L3 larval stage. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

231 bp deletion removes all of exons 2 and 3 and throws the remaining portion of the proten (which contains the RGS domain) out of frame. Deletion endpoints are: GCAGCTCACGGAGCCCGGAGTT...CACCGTCGCCAAGACTTAGGTA.

328 bp deletion which completely removes exons 8 and 9. The first 22 bp deleted are: cgttagtcccccttttaaaatt.

Temperature sensitive Egl and Unc. 318 pb deletion including exons 6 and 7. Possibly an allele of exp-3.

Removes mir-80, mir-81, mir-82, mir-227, and T07D1.2 (exons 2-6). Reference: Alvarez-Saavedra E, Horvitz HR. Curr Biol. 2010 Feb 23;20(4):367-73.

Deletion of K09F5.5, a putative SET-domain-encoding gene. From 2002 deletion library. This deletion removes from the middle of the second exon to the middle of the fourth exon. It is predicted to remove exons that encode the AWS, SET and PostSET domains.

WT phenotype. From Horvitz 2002 deletion library; deletion removes exons 4, 5, and 6 causing a frame shift after amino acid 165. This should remove last three MBT repeats. Y48G1A.6.

n4871 is a 1136 bp deletion that removes the last five exons, including the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.

n4872 is a 722 bp deletion that removes part of exon 2 and all of exons 3 and 4. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.

wdIs5 [unc-4p::~1.5 exons of the unc-4 gene::GFP + (pMH86) dpy-20(+)]. Slightly Unc. GFP expression mosaic, occasional DA axon guidance defects. Embryonic expression: I5, DA, SABs; L1: AVF, VA; late L3: VC.

pkIs689 [gpa-1::GFP + dpy-20(+)]. Reporter construct includes 1.5 kb upstream and the first 8 exons of gpa-1 fused in frame with GFP. 4.3 kb HindIII - BglII fragment cloned in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs582 [gpa-5::GFP + dpy-20(+)]. Reporter construct includes 4.5 kb upstream and the first 5 exons of gpa-5 fused in frame with GFP. 4.5 kb PstI - BamHI fragment cloned in pPD95.79. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

Lethargic in the absence of stimulation. 1500 bp deletion including the promoter and first three exons of C. elegans rabphilin homolog.

Viable, fertile, with no obvious behavioral or morphological phenotypes. A 1677 bp deletion in the C18H9.7 gene which encodes a C. elegans homolog of the rapysn (vertebrate) gene. The lesion deletes exons 4 through 10, leaving exons 3 and 11 in frame. The deletion junction is cagaagaaaaagttcgctttgaactaaAGAACCTATTGAAAATTCTTACTT. Previously called rap-1.

Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).

Null allele generated by gRNAs targeted to the first and last exons of ceh-14, resulting in a 4061bp deletion from +35 to +4098 relative to the start of the ORF.

Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

Null allele of unc-30 generated by gRNAs targeted to the first and last exons, resulting in a 5168 bp deletion from -37 to +5131 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1409 is a deletion removing exons 1-7 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1433 is a deletion removing exons 4-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 1-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

Deletion that spans exons 1-3 (out of 4) and is presumed to be a null. Under EM, one type of intestinal granule is missing. Missing type is not acidic, and does not stain with nile red. Under DIC, gut is lighter and the granules are not as densely packed.

GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. [NOTE: Previously described as ceh-44(syb5437[gfp::ceh-44]) III. ceh-44 and cone-1 are located in the same locus and may share many exons, but are two separate genes with different functions and expression patterns. Please contact Oliver Hobert prior to publishing work using this strain.

Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-5. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: gATGAAAATGCAGATCTCCTCGCGTACACCAAAA right flanking sequence: CGTTGGCTTGCCGAGGTGAACATTGTAGATGTTG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCTCGGCAAGCCAACGTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616