| BW1118 |
C. elegans |
mel-25(ct60) unc-42(e270)/unc-23(e25) vab-8(e1017) V; lon-2(e678) X. Show Description
Maintain by picking Lon non-Unc. Throws Lon non-Unc, Lon Unc Vab (bent head, tails very thin), and Lon Unc Mel (kinker, temperature-sterile).
|
|
| BW1199 |
C. elegans |
him-8(e1489) IV; unc-42(e270) sma-1(e30) V; ctDp8[vab-8(e1017)] (V;f). Show Description
|
|
| CB1017 |
C. elegans |
vab-8(e1017) V. Show Description
Degenerate tail. Posterior half is thin, pale, uncoordinated.
|
|
| MT3773 |
C. elegans |
unc-42(e270) vab-8(e1017) V. Show Description
Unc. Posterior half thin and pale.
|
|
| RG3517 |
C. elegans |
slc-25A26(ve1017[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Late larval arrest. Deletion of 1778 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow moving larvae (ve1017 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ATTTTAAATATGGAGTAATTTAGGATGCCA; Right flanking sequence: CGGTGGTTTTGTTTTCTTCGGTGCCTATGA. slc-25A26 crRNA A: ACCACCGATCCTTCTTCTGA; slc-25A26 crRNA B: CGTGTAATGTGGATTTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| SP1493 |
C. elegans |
sma-1(e30) unc-76(e911)/vab-8(e1017) V. Show Description
Heterozygotes are WT and segregate WT, SmaUnc and animals with a posterior half that is thin, pale, uncoordinated.
|
|
