Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB1001 C. elegans flu-3(e1001) II. Show Description
Increased gut fluorescence, purple. M-MATING++ 1-10%WT. Recessive.
RG3501 C. elegans F58G1.2(ve1001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Sterile. Deletion of 3478 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve1001 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TATTGTAAACATTAAAATGTGGGAAAACTG; Right flanking sequence: TCCTGATTGTTCCTGTAATTAATTGCATTA. F58G1.2 crRNA A: GGTGAAATCGTCATTGAACG; F58G1.2 crRNA B: CAAGCAACGAGAAACAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CT21 C. elegans zaIs2. Show Description
zaIs2 [lin-14::GFP + rol-6(su1006)]. Rollers, though Rol is not completely penetrant, Reference: Olsson-Carter K, Slack FJ. PLoS Genet. 2010 Aug 5;6(8). pii: e1001054.
DR2386 C. elegans daf-25(m362) I. Show Description
Maintain at 15C. Daf-C. Reference: Jensen VL, et al. PLoS Genet. 2010 Nov 24;6(11):e1001199.
EG4348 C. elegans C. elegans wild isolate. Show Description
Utah natural isolate carrying peel-1(qq99) I. EG4348 was collected by M. Ailion from Salt Lake City, UT. qq99 designates the naturally occurring nonsense mutation in peel-1. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
EG5389 C. elegans oxIs494 II; unc-119(ed3) III. Show Description
oxIs494 [peel-1p::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP remains in the residual body and is not packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
EG5767 C. elegans qqIr7 I; oxSi78 II; unc-119(ed3) III. Show Description
qqIr7 [peel-1(qq99)] I. oxSi78 [peel-1p::peel-1 (introns included)::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. Genetic background is a mixture of N2 and wild isolate EG4348. The oxSi78 insertion produces a PEEL-1::GFP translational fusion. PEEL-1::GFP is expressed in the spermatogenic germline and packaged into sperm. PEEL-1::GFP appears to localize to fibrous body-membranous organelles. PEEL-1::GFP does not rescue peel-1(qq99). Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
EG5801 C. elegans oxSi87 II; unc-119(ed3) III. Show Description
oxSi87 [peel-1p::N-terminal 12 amino acids of PEEL-1::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP is packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
GV1 C. elegans ets-4(uz1) X. Show Description
Reference: Thyagarajan et al. PLoS Genet. 2010 Sep 16;6(9). pii: e1001125.
GV796 C. elegans ets-4(ok165) lin-15B&lin-15A(n765) X; uzEx710. Show Description
uzEx710 [gly-19p::YFP::ets-4 + lin-15(+)]. Maintain by picking wild-type (non-Muv). Reference: Thyagarajan et al. PLoS Genet. 2010 Sep 16;6(9). pii: e1001125.
GV807 C. elegans ets-4(ok165) lin-15B&lin-15A(n765) X; uzEx721. Show Description
uzEx721 [rab-3p::YFP::ets-4 + lin-15(+)]. Maintain by picking wild-type (non-Muv). Reference: Thyagarajan et al. PLoS Genet. 2010 Sep 16;6(9). pii: e1001125.
GV812 C. elegans ets-4(ok165) lin-15B&lin-15A(n765) X; uzEx726. Show Description
uzEx726 [lin-15(+)]. Maintain by picking wild-type (non-Muv). Reference: Thyagarajan et al. PLoS Genet. 2010 Sep 16;6(9). pii: e1001125.
IK732 C. elegans maco-1(nj21) I. Show Description
Reference: Miyara A, et al. PLoS Genet. 2011 May;7(5):e1001384.
IK734 C. elegans maco-1(nj34) I. Show Description
Reference: Miyara A, et al. PLoS Genet. 2011 May;7(5):e1001384.
JIM271 C. elegans ujIs113 II; stIs10286. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10286 [nob-1::GFP::unc-54 3'UTR + rol-6(su1006)]. stIs10286 contains 9kb promoter and full nob-1 transcript fused to GFP. Reference: Zhao Z, et al. PLoS Genet. 2010 Sep 2;6(9):e1001089.
JK3025 C. elegans gld-1(q485) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Jeong J, et al. PLoS Genet. 2011 Mar;7(3):e1001348.
JK4626 C. elegans cku-80(ok861) unc-119(ed3) III; qIs170. Show Description
qIs170 [gld-1p::gld-1::GFP::FLAG + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. Reference: Jeong J, Verheyden JM, Kimble J. PLoS Genet. 2011 Mar;7(3):e1001348.
KWN190 C. elegans pha-1(e2123) III; him-5(e1490) V; rnyEx109. Show Description
rnyEx109 [nhx-2p::D3cpv + pha-1(+)]. Maintain at 20-25C to select for array. KWN190 strain expresses the FRET-based calcium indicator protein D3cpv throughout the cytoplasm of intestinal cells. Dual emission ratio imaging (ex. 435, em. 480/535-nm) can be used to measure intestinal calcium and, although the FRET pair is CFP/YFP, intestinal D3cpv fluorescence is observable under standard GFP filter sets. The D3cpv biosensor has the advantages of being relatively pH-insensitive and not interfering with endogenous calmodulin signaling. References: Am J Physiol Cell Physiol. 301:C1389-1403. Am J Physiol Cell Physiol. 297:C1071-81. FASEB J. 27:760-768. PLoS Biol. 11: e1001613.
LD1171 C. elegans ldIs3. Show Description
ldIs3 [gcs-1p::GFP + rol-6(su1006)]. Rollers. Reference: Wang J, et al. PLoS Genet. 2010 Aug 5;6(8). pii: e1001048.
LE1837 C. elegans rack-1(tm2262) IV. Show Description
Sick. Low brood size. Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.
LE2113 C. elegans lin-15B&lin-15A(n765) X; lqEx463. Show Description
lqEx463 [rack-1::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.
LE2290 C. elegans lqIs126. Show Description
lqIs126 [rack-1::MYC + osm-6::GFP]. lqIs126 rescues sterility, gonadal distal tip cell migration defects, and axon pathfinding defects caused by rack-1(tm2262). Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.
LE479 C. elegans juIs76 II; ced-10(n1993) lqIs3 IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs3 [osm-6::GFP] IV. Cell engulfment defect at 2-fold stage. Reference: Demarco RS & Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.
QX1409 C. elegans qqIR7 (I: peel-1(qq99), EG4348>N2); ttTi5605 II; unc-119(ed3) III. Show Description
Nonsense allele of peel-1 carried in Utah isolate EG4348 crossed into N2 Bristol background. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115.
TG1540 C. elegans gen-1(tm2940) III. Show Description
Reference: Bailly AP, et al. PLoS Genet. 2010 Jul 15;6(7):e1001025. Agostinho A, et al. PLos Genetics 2013.
YE57 C. elegans smc-5(ok2421)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2421 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok2421 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.
YE58 C. elegans smc-6(ok3294)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3294 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok3294 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.
YE59 C. elegans smc-5(tm2868)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm2868 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. tm2868 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.
ZH1963 C. elegans enIs59 I; unc-76(e911) V. Show Description
enIs59 [ced-1p::2xFYVE::GFP + unc-76(+)] I. ced-1p::2xFYVE::GFP is a phosphainositol PtdIns(3)P reporter expressed in engulfing cells for assaying cell corpse clearance and other membrane trafficking events. GFP expression from enIs59 is relatively low and causes the least deleterious effects to worm development. Reference: Lu N, et al. PLoS Biol. 2012 Jan;10(1):e1001245. PMID: 22272187