Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB262 C. elegans unc-37(e262) I. Show Description
Coiler Unc. Severe. Recessive. M-MATING+POOR <1%WT.
HH16 C. elegans cdc-25.2(b262) unc-60(m35) V. Show Description
Unc. Temperature sensitive-maintain at 15C.
HH17 C. elegans unc-60(m35) cdc-25.2(b262) dpy-11(e224) V. Show Description
Dpy. Unc. Temperature sensitive-maintain at 15C.
CB2620 C. elegans daf-9(e1406)/lon-2(e678) X. Show Description
Heterozygotes are WT and segregate WT, lethal dauers (DAUER-LIKE LARVAE) and Lon. Can recombine; check for correct segregation of progeny to maintain.
CB2621 C. elegans unc-15(e73) I; eDf1 eDp21/sma-1(e30) V. Show Description
Heterozygotes are slow moving. Segregates paralysed small. eDf1 eDp21 homozygotes die in larval development.
CB2627 C. elegans lin-4(e912)/dpy-10(e128) II. Show Description
Heterozygotes are WT and segregate WT, Dpy and Vulvaless. Maintain by picking WT.
RB2620 C. elegans daf-14(ok3647) IV. Show Description
F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2622 C. elegans gcy-27(ok3653) IV. Show Description
C06A12.4 Homozygous. Outer Left Sequence: tcgccttgtttactgcctct. Outer Right Sequence: cgctactgcgaacgagtttt. Inner Left Sequence: ctggttggcagttttccagt. Inner Right Sequence: aaacgtttttgttccctttgaa. Inner Primer PCR Length: 1277. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2623 C. elegans F39B2.7(ok3674) I. Show Description
F39B2.7 Homozygous. Outer Left Sequence: acgttttgacagaaatcggg. Outer Right Sequence: tgacgtcattgaggcagaag. Inner Left Sequence: ggcactggaaaagagacaaga. Inner Right Sequence: acgtgctcaaaaacgaatcc. Inner Primer PCR Length: 1228. Estimated Deletion Size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2624 C. elegans Y105C5B.12(ok3675) IV. Show Description
Y105C5B.12 Homozygous. Outer Left Sequence: cattgtgtccaaagtgtccg. Outer Right Sequence: ctgatttctggctctacggg. Inner Left Sequence: gcggttggttcataaattgg. Inner Right Sequence: ggtgagatcacctcgaaagc. Inner Primer PCR Length: 1118. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2625 C. elegans F40F12.7(ok3684) III. Show Description
F40F12.7 Homozygous. Outer Left Sequence: aggcaaaccataagcctgaa. Outer Right Sequence: catctttgattttcccgcat. Inner Left Sequence: tggtttttgcattttcaacc. Inner Right Sequence: aaaacactggatccgcattg. Inner Primer PCR Length: 1232. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2626 C. elegans R03A10.6(ok3685) X. Show Description
R03A10.6 Homozygous. Outer Left Sequence: gtcggacgcacagctaagtt. Outer Right Sequence: ggccccaaactacaaacaaa. Inner Left Sequence: gtccgacaatttttgggttc. Inner Right Sequence: aagcatgctccttcttctcg. Inner Primer PCR Length: 1179. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2627 C. elegans srg-69(ok3686) II. Show Description
F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2628 C. elegans Y73B3B.2(ok3687) X. Show Description
Y73B3B.2 Homozygous. Outer Left Sequence: tgaaaacgtgctcgtacacc. Outer Right Sequence: atgactacggtagatggcgg. Inner Left Sequence: tcgtgcaaagtttgagcatt. Inner Right Sequence: ggaccgaaacatttttgcat. Inner Primer PCR Length: 1130. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2629 C. elegans Y46G5A.35(ok3697) II. Show Description
Y46G5A.35 Homozygous. Outer Left Sequence: cttcaggaatcggtttcagc. Outer Right Sequence: agaagccgaagagaaaagcc. Inner Left Sequence: taatctcctcctcagccgtc. Inner Right Sequence: cacatgaagcgtcttcggta. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807