Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CX12709 C. elegans avr-14(ad1302) I. Show Description
Decreased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
DA1371 C. elegans avr-14(ad1302) I. Show Description
WT. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC.
DA1302 C. elegans avr-14(ad1305) I; avr-15(ad1051) V. Show Description
Moderate resistance to ivermectin. NOTE: originally described as carrying ad1302, but reported to actually be ad1305; see strain JD740 for verified avr-14(ad1302) I; avr-15(ad1051) V double mutant. Do not distribute this strain; other labs should request it from the CGC.
DA1384 C. elegans avr-14(ad1302) I; glc-1(pk54) V. Show Description
glc-1(pk54::Tc1). High level of ivermectin resistance. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC.
JD740 C. elegans avr-14(ad1302) I; avr-15(ad1051) V. Show Description
Modest ivermectin resistance. Mild feeding defect. Lacks M3 neurotransmission. Reference: Dent JA, et al. Proc Natl Acad Sci U S A. 2000 Mar 14;97(6):2674-9.
DA1316 C. elegans avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. Show Description
Highly resistant to ivermectin. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. Received new stock 5/21/08. [NOTE: The correct genotype of this strain is avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-14(ad1302) I; avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.]
JD608 C. elegans avr-14(ad1302) I; avr-15(ad1051) glc-1(pk54) V. Show Description
Slow pumping. High reversal frequency. Ivermectin resistant. This strain is a replacement for the strain DA1316 currently in the CGC stock and whose genotype is actually avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.
FT1310 C. elegans avr-14(ad1302) I; xnSi31 II; unc-119 (ed3) III; glc-1(pk54::Tc1) avr-15(ad1051) V. Show Description
xnSi31 [sec-8::mCherry + unc-119(+)] II. Expresses sec-8::mCherry maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
FT1379 C. elegans avr-14(ad1302) I; xnSi34 II; unc-119 (ed3) III; glc-1(pk54::Tc1) avr-15(ad1051) V. Show Description
xnSi34 [sec-15::YFP + unc-119(+)] II. Expresses sec-15::YFP maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
WM186 C. elegans avr-14(ad1302) I; ttTi5605 II; unc-119(ed3) III; avr-15(ad1051) glc-1(pk54) V; neEx15. Show Description
neEx15 [myo-2::RFP + myo-2::avr-15(+) + unc-119(+)]. MosSCI recipient strain. neEx15 rescues unc-119, making the worms healthier for injection. The array is counter-selectable. Reference: Shirayama M, et al. Cell. 2012 Jul 6;150(1):65-77.
WM214 C. elegans avr-14(ad1302) I; csr-1(tm892)/nT1 [unc-?(n754) let-?] IV; avr-15(ad1051) glc-1(pk54))/nT1 V; axIs36 X. Show Description
axIs36 [pes-10::GFP]. Heterozygotes are Unc and sensitive to ivermectin. Segregates csr-1 homozygotes (sterile, non-Unc, resisitant to ivermectin), dead embryos, and Unc heterozygotes. Maintain by picking Uncs. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM215 C. elegans avr-14(ad1302) ego-1(om97) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V. Show Description
Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP ego-1 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM216 C. elegans avr-14(ad1302) drh-3(tm1217) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V. Show Description
Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP drh-3 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
RG3443 C. elegans avr-14(ve943[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Prone to rupture at vulva, can be maintained as a homozygous population. Deletion of 5798 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAGGTAATCGTTTAACACTACGATATGCT ; Right flanking sequence: agggctttttcttttttctctctttatcct. avr-14 sgRNA A: GATAAATCTAATCGAAGTGG; avr-14 sgRNA B: aagggacaggggacgaaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
JD204 C. elegans vuEx90. Show Description
vuEx90 [avr-14p::GFP]. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.