Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CA998 C. elegans ieDf2 [unc-119+]/mIs11 IV. Show Description
mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. Heterozygotes are wild-type with dim GFP signal in the pharynx. mIs11 homozygotes are wild-type with bright GFP in the pharynx. ieDf2 homozygotes (non-GFP) develop normally but produce 97.5% inviable embryos and a high frequency of males among the surviving self-progeny. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. GFP expression in 4-cell embryos, pharyngeal muscle and gut. ieDf2 is a deficiency of zim-1, zim-2, zim-3, and him-8 generated by MosDel, resulting in single-copy insertion of a copy of the C. briggsae unc-119 gene on Chromosome IV. The deletion spans the sequences from the beginning of the zim-1 coding sequence through the ttTi22866 Mos1 insertion site.
CB6503 C. elegans bgIs312 I; him-8(e1489) IV; bus-17(e2923) X. Show Description
bgIs312 [pes-6::GFP]. GFP expression in excretory cell only. Bus (resistant to infection by M. nematophilum and Leucobacter Verde2), hypersensitive to Leucobacter Verde1, bleach-sensitive, drug-sensitive; Him (high incidence of males). e2923 is a Mos1 insertion in bus-17 (ZK678.8). Reference: Yook & Hodgkin (2007), Genetics 175: 681-697
DLW14 C. elegans unc-5(lib1[myo-3p::GFP(-) + unc-119(+) + myo-2p::GFP(Mos1)]) IV; krIs14 V. Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008
EG1470 C. elegans oxEx229. Show Description
oxEx229 [Mos1 Substrate + myo-2::GFP]. Should be grown at 25C.
EG4322 C. elegans ttTi5605 II; unc-119(ed9) III. Show Description
Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]
EG4887 C. elegans oxIs322 II; unc-119(ed3) III. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus.
EG5003 C. elegans unc-119(ed3) III; cxTi10882 IV. Show Description
Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).
EG6032 C. elegans ttTi4348 I; unc-18(md299) X. Show Description
Unc. MosSCI insertion strain with unc-18 marker instead of unc-119. Mos1 insertion in Chr I. Compatible with mosSCI targeting vectors pCFJ448 (Gateway) and pCFJ676 (MCS).
EG6250 C. elegans unc-119(ed3) III; cxTi10882 IV. Show Description
Unc. Not caused by cxTi10882. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). Grows best on HB101 bacteria. Reference: Frokjaer-Jensen C, et al., Nat Genet. 2008 Nov;40(11):1375-83.
EN17 C. elegans catp-1(kr17) I. Show Description
DMPP resistant. Mos1 insertion.
EN26 C. elegans lev-10(kr26::Mos1) I. Show Description
Weakly resistant to 1mM levamisole in acute screen. Animals become paralyzed after >30 min but nose remains hypercontracted. Sluggish Unc. pka lev-10.
EN5271 C. elegans (kr5271) I. Show Description
Mos1 transposon insertion in LG I. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR261 (Chr I 5'gaaatagagggcagttcaacg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.
EN5273 C. elegans (kr5273) X. Show Description
Mos1 transposon insertion in LG X. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR266 (Chr X 5'gacaaagacgtgtagttgcg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.
HCC21 C. elegans hwSi3 II; unc-119(ed9) III. Show Description
hwSi3 [pie-1p::GFP::mex-3::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing full-length MEX-3 uniformly throughout oocytes and early embryos through the 4-cell stage. GFP::MEX-3 then mirrors endogenous MEX-3, disappearing from somatic cells by about the 12-cell stage. Also detected in P granules. GFP::MEX-3 can replace endogenous MEX-3. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.
HCC27 C. elegans hwSi8 II; unc-119(ed9) III. Show Description
hwSi8 [pie-1p::GFP::mex-3(601-1248)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing a portion of MEX-3(601-1248) required for protein degradation. At about the 12-cell stage, soma-germline asymmetry is briefly visible before GFP::MEX-3(601-1248) becomes undetectable even in the germline blastomeres. Detected weakly on P granules only in the presence of endogenous MEX. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.
HCC31 C. elegans hwSi13 II; unc-119(ed9) III. Show Description
hwSi13 [pie-1p::GFP::mex-3(2-636)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing truncated MEX-3 that is missing a portion required for protein degradation. GFP::MEX-3(2-636) is extraordinarily stable, persisting in somatic cells through the comma stage (~550 cells) at levels similar to those in 1- and 2-cell embryos. Also detected on P granules through hatching. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.
IG113 C. elegans frP1 III. Show Description
Mos1 transposon insertion: F28F5 (at position 1023) acacctggtaCTCACCCCTGTTTAACACACAGTCTTCACA. Mos1 sequence is in lowercase.
IG114 C. elegans frP2 III. Show Description
Mos1 transposon insertion: T28A8 (at position 2841) acacctggtaTTAAGAAAAAAACCGAGTCCTCTCACCGTA. Mos1 sequence is in lowercase.
IG115 C. elegans frP3 V. Show Description
Mos1 transposon insertion: CO8D8 (at position 17534) acacctggtaATAAAAGAAGGAAAAATAAATATTTAAGTT. Mos1 sequence is in lowercase.
IG117 C. elegans frP41 IV. Show Description
Mos1 transposon insertion: Y38C1AB (at position 8906) acacctggtaCAACTGGTTTAGAATAATTTAGAAATTACAA. Mos1 sequence is in lowercase.
IG118 C. elegans frP5 V. Show Description
Mos1 transposon insertion: F57F4 (at position 15459) acacctggtaGTCTCTTCAAGGAAGAACAATGAGAAATAA. Mos1 sequence is in lowercase.
IG119 C. elegans frP7 IV; frP6 X. Show Description
Mos1 transposon insertion: frP6: F39H12 (at position 19268) acacctggtaAGCATAGGGCTAGGCCTTAGACTTTATATT, and frP7: Y10G11A (at position 1294) acacctggtaAAACAATTTCCAAGTAAAAAAATCATGTATT. Mos1 sequence is in lowercase.
IG122 C. elegans frP8 frP9 III. Show Description
Mos1 transposon insertion: frP8: H14A12 (at position 9047) acacctggtaTACAATTTTGATTTCAGAAAGTTCTCTGAC, and frP9: Y45F3A (at position 220) acacctggtaGAATTGTTCGAACAAGCTTCAACGAGAAAGCAA. Mos1 sequence is in lowercase.
IG123 C. elegans frP10 X. Show Description
Mos1 transposon insertion: B0272 (at position 11068) acacctggtaTATGAGAAAATCTATAGCAAGTACATATCT. Mos1 sequence is in lowercase.
IG124 C. elegans frP11 I; frP13 II; frP14 III; frP12 X. Show Description
Mos1 transposon insertions: frP11: F31C3 (at position 26364) acacctggtaTCGGAGGAGCTGCCAAATGGCGTCCGACTT. frP12: F01E11 (at position 3748) acacctggtaCAATCGAAAATCATTGAAATCAGTTAACAG. frP13: Y38E10A (at position 40384) acacctggtaTAGCTAGAGGACTGTCCCGGTCTAAAATGA. frP14: F53A2 (at position 34332) acacctggtaTATTATAAAAGATGTATGAAATGTCGTGAA. Mos1 sequence is in lowercase.
IG125 C. elegans frP15 IV. Show Description
Mos1 transposon insertion: Y97E10B (at position 1022) acacctggtaAAACATGCTGAAAGTTTACTAAAATTGAAT. Mos1 sequence is in lowercase.
IG126 C. elegans frP16 III. Show Description
Mos1 transposon insertion: Y39A3CL (at position 24032) acacctggtaTATCGAAAAAAAATTTTTTTTTGGAATTTT. Mos1 sequence is in lowercase.
IG127 C. elegans frP17 IV. Show Description
Mos1 transposon insertion: K07H8 (at position 8196) acacctggtaTTATCAAAGTTAGAATTCAAACTGCGTTGC. Mos1 sequence is in lowercase.
IG128 C. elegans frP20 frP19 II; frP18 V. Show Description
Mos1 transposon insertions: frP18: K03H4 (at position 19156) acacctggtaGAATGGATGAGGTTGAAAGTGACGAAGAAAA. frP19: F35H8 (at position 15891) acacctggtaGTTTACTCATATTTCTTTCCTCTCTTCTTC. frP20: T14B4 (at position 25648) acacctggtaTGCAAATATGGTTAATGTAAGGCATTTTTG. Mos1 sequence is in lowercase.
IG129 C. elegans frP21 IV. Show Description
Dumpy. Mos1 transposon insertion: F30B5 (at position 22345) (dpy-13) acacctggtaGTTGTAGACGATTGGAAGAGTAATGCAAAC. Mos1 sequence is in lowercase.
IG358 C. elegans oxEx229. Show Description
oxEx229 [Mos1 Substrate + myo-2::GFP]. Pick GFP+ to maintain. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.
JN1209 C. elegans pitp-1(pe1209) III. Show Description
Mos1 insertion. Salt chemotaxis learning defective. Reference: Proc Natl Acad Sci U S A. 2011 May 3;108(18):7589-94.
JU929 C. briggsae Cbr-dpy-18(mf104). Show Description
Mos1 insertion in CBG13195 = Cbr-dpy-18 in exon before TATgtgagtcgatttgtttgatcgg. Dpy phenotype.
MS123 C. elegans med-2(cx9744) III. Show Description
Mos1 insertion into coding region of K04C2.6 (med-2). No obvious phenotype.
NM5322 C. elegans jsSi1570 I; bqSi711 IV. Show Description
jsSi1570 [delta_mosL::loxP::rpl-28::FRT::GFP::his-58::FRT3::mosR] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chromosome I. Derivative of jsTi1453 lacking the left mos1 arm.
QS1 C. elegans chep-1(qr1). Show Description
Weak chemotaxis toward diacetyl. Possibly due to the weak chemotaxis toward diacetyl, qr1 were more preferentialy attracted by sodium acetate than WT in simultaneous two-spot presentation of sodium acetate and diacetyl. Mutagen used was Mos1 transposon, but it is not an insertion allele.
QS2 C. elegans chep-2(qr2). Show Description
Weak chemotaxis toward low concentrations of sodium acetate. qr2 were more preferentialy attracted by diacetyl than WT in simultaneous two-spot presentation of sodium acetate and diacetyl. Mutagen used was Mos1 transposon, but it is not an insertion allele.
ZG449 C. elegans iaIs7 IV; egl-9(ia61) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. ia61 was induced by Mos1 mutagenesis. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).