Search Strains

GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]

Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA

Deletion breakpoints are: AACAACAACAAAAACTTTTTTTACC / ATTTAAAAAAATAA...GAATGGGAAAAAAAA / GGAAGCTGTGGCCTGTCGCATAGTTAC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TATCTTCTTATTCGGGGCGTCCTTG / TACCTATCTTG...AAATTTTCTGTA / GGTCTTAAATTTTTTCCTAACAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are: GTACCTAGACAATATTCCT / CACCAACCTCAATTCAACAC...GGCTTAAGCTTAGGCGAATA / CAATCAATTTTTCAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TTGAAGTTGCTCCGGACAAAAA / GCAGCCATCAGTCT...TCTCTCCAAGGTTGTA / ACAGGAGACGACGACCACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TCTACCGAACTTCGCATAAT / TTCCAATTTTCAATTTCCA...ACAATTTGAAAATAAAAA / TTTGCAGAAAAAGTTGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-22; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACGCGTTACTTTTTGTGTCAAACAGACCAAAAA Right flanking sequence: CTGTGGCAGAGGACTATTTTACAATGgtaggtgctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTCAAACAGACCAAAAACTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagTGGCAACCTACAACAAATTTCTCGCCGATCAA right flanking sequence: AAACGGCTTTGGGATGATTTATTCAAAGATTATGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTTCTCGCCGATCAAAAA Method Reference: G3 (Bethesda).

K08E3.4. Homozygous. Outer Left Sequence: GGATGGACTCGAACCAAAAA. Outer Right Sequence: TTCTGGAGGGTCTCTGCCTA. Inner Left Sequence: TTGCAGGAAACACAACGAAG. Inner Right Sequence: CAAATTTGCCATATGTTGCG. Inner Primer WT PCR product: 2983. Deletion size: 1146 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17E7.5. Homozygous. Outer Left Sequence: TTCTTGTGCGAAAAATTCCC. Outer Right Sequence: TATGCACCAAACACGCAAAT. Inner Left Sequence: CTCAGACAACTGTGGCGAAA. Inner Right Sequence: ATTGCGCAACGTGAATTTTT. Inner Primer PCR Length: 3294 bp. Deletion Size: 1242 bp. Deletion left flank: AAAACTCCATAAAAATTACCTTTTTAAAAA. Deletion right flank: ACACAGTAGTGTTTAAGCAAGATTTTCTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05F9.10, R05F9.1b. Homozygous. Outer Left Sequence: TTGTAAGGGGAAATTCTGCG. Outer Right Sequence: TGACGAGGGACACACAAAAA. Inner Left Sequence: AGGAGATTGGCGGAAGAGAT. Inner Right Sequence: AGTCGCAGGTTTAGCTCCAA. Inner Primer WT PCR Product: 3317. Deletion size: 2275 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37H9A.6. Homozygous. Outer Left Sequence: CATATTGCCCAGAAATGGCT. Outer Right Sequence: CCGAGAAGCTTTTGCTCTGT. Inner Left Sequence: AGTGGCAAAAATGGCAAAAA. Inner Right Sequence: GATTTGAAGCCCAAAGAGCA. Inner Primer WT PCR Product: 2133. Deletion size: 785 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.3 Homozygous. Outer Left Sequence: tgcttcgattgattgctcac. Outer Right Sequence: ggaggttacgcatccaaaaa. Inner Left Sequence: tcggattttcctttgcattc. Inner Right Sequence: ttcgcctcctatatcccctt. Inner Primer PCR Length: 2845. Estimated Deletion Size: about 2050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y82E9BR.14 Homozygous. Outer Left Sequence: ggggttcaggagggtaaaaa. Outer Right Sequence: atttgaagaatttcgcgtgc. Inner Left Sequence: cacgttaagccggaaattgt. Inner Right Sequence: gcgtcacggctagatttttc. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.1 Homozygous. Outer Left Sequence: ttcaaatgcattgccaaaaa. Outer Right Sequence: ttggcaacaacaaagcagag. Inner Left Sequence: cctccgaattttcccatttt. Inner Right Sequence: aaagctgaaggatctgccaa. Inner Primer PCR Length: 2932. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28C6.1 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms as the balancer may break down. ok1264 animals are homozygous viable. Outer Left Sequence: TCCCTGTTCCATTTTTGAGC. Outer Right Sequence: CATCACCTCTACCACCCCAT. Inner Left Sequence: AAGCCAAGAATTCGCAAAAA. Inner Right Sequence: CAACACCACCATGACCTGAA. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04B5.5 Homozygous. Outer Left Sequence: gaagcgaggtctacagtccg. Outer Right Sequence: cgtcgaaaagaacccaaaaa. Inner Left Sequence: gtggtgggacccatattgag. Inner Right Sequence: tctgcctgaaaaggctgatt. Inner Primer PCR Length: 2929. Estimated Deletion Size: about 330 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57B1.2 Heterozygotes are WT and GFP+. Outer Left Sequence: tgattcccaggaaccaaaaa. Outer Right Sequence: tctgtgcctgccaaatcata. Inner Left Sequence: aaaacgaaaacggcactttg. Inner Right Sequence: aattacaattccgcacaggc. Inner Primer PCR Length: 2136. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C11D2.2 Homozygous. Outer Left Sequence: aggccgattgcattgataag. Outer Right Sequence: ggggcaattttcaacaaaaa. Inner Left Sequence: ggtttgatcgacttgttggg. Inner Right Sequence: cccgatccgtttattcttga. Inner Primer PCR Length:3169. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02B12.8, W02B12.7. Homozygous. Outer Left Sequence: CCGGTTTCCAGATTCAAAAA. Outer Right Sequence: AAGAGCGAGAAGTGGCCATA. Inner Left Sequence: AGTGCATCCAACACGATTCA. Inner Right Sequence: AATGCAAAAGCTGAACACCC. Inner Primer PCR Length: 2898 bp. Deletion Size: 1008 bp. Deletion left flank: AACTCCGGATTGGGCGGTCGGAGGAAAGAA. Deletion right flank: AGAATTAATAAAGGTATTTAATAGGCTAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06F6.2 Homozygous. Outer Left Sequence: gtcatgggcctcgttaggta. Outer Right Sequence: ccacaaattccatttttgcc. Inner Left Sequence: caaatttacgactttgccgc. Inner Right Sequence: gattcaaattcccgcaaaaa. Inner Primer PCR Length: 3189. Deletion size: 1927 bp. Left flank: CGTCCTCATTCTTTTTATTAATAAATCGAT. Right flank: TGTCCAGTACTTTCATCAAAAGTCCAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28D9.1 Homozygous. Outer Left Sequence: aaaaagcagggaattgcaga. Outer Right Sequence: cgctgcgtttttattggttt. Inner Left Sequence: cttcttatgcttcttggcgg. Inner Right Sequence: atgaagtttgagccgcagtt. Inner Primer PCR Length: 2889. Deletion size: 698 bp. Left flank: ACTGCCAATTTGCTGCAAAAAATTCAAAAA. Right flank: TTCAAATTCTTATCATCAATCTGTGATAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y77E11A.10. Homozygous. Outer Left Sequence: TGCTTTCTAGGCCCACTTGT. Outer Right Sequence: CCTTGTTGGGTCATTTCCAC. Inner Left Sequence: TCGAAATTTGGACCTTCTCG. Inner Right Sequence: ATTTTCCAGCCAACAACTCG. Inner Primer PCR Length: 3274 bp. Deletion Size: 2386 bp. Deletion left flank: TTTTTTTGGGACGAAAAAATTCGCAAAAAA. Deletion right flank: GGATCCTTGTCTAACATCGAATCGGCTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01H10.8. Homozygous. Outer Left Sequence: ggttccgacgcaaataaaaa. Outer Right Sequence: tcacgcaatctcatccaaaa. Inner Left Sequence: aatctccacgttttggttgg. Inner Right Sequence: agcaccgtcgtagctcagtt. Inner Primer PCR Length: 3120. Deletion Size: 884. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02C12.1. Homozygous. Outer Left Sequence: AGGGGATGGGAGAGGAAGTA. Outer Right Sequence: TCGAATTGGTGTTGAAGCAG. Inner Left Sequence: GGCATCAAACACACGAATTG. Inner Right Sequence: TGACCTTGTGGAAATCCCTC. Inner Primer PCR Length: 2991 bp. Deletion Size: 1523 bp. Deletion left flank: CGTCACAAGATAAAACTAATCTCCAAGCTA. Deletion right flank: GGCCAAGATATCTGACCTGAAAATAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W01C8.4. Homozygous. Outer Left Sequence: CATGCAAGACGAGGAGACAA. Outer Right Sequence: GCGCGTTGCATCTAAAATCT. Inner Left Sequence: TTGTTCACAAATGGCGGATA. Inner Right Sequence: CCCGTTGTGACCTTCAGTTT. Inner Primer PCR Length: 3309 bp. Deletion Size: 2544 bp. Deletion left flank: CAAAATGATGCAACCAACTGTAAATTTTTT. Deletion right flank: CTCTTTTTGTTTTTTGTCGCATCCTAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33H5.14. Homozygous. Outer Left Sequence: TTTCCTAATGTCGGGGTGAG. Outer Right Sequence: CAACGGTGAGCACTTCAAGA. Inner Left Sequence: GCCGAATTTGTTGCACTGTA. Inner Right Sequence: TGGAAAGCATGATGAACCAA. Inner Primer PCR Length: 3523 bp. Deletion Size: 2298 bp. Deletion left flank: TCCTAGAGCCCATTGCATTTCTTCACCGGC. Deletion right flank: TTAGATCTTCAATGAAATTGGTCAGAAAAA. Insertion Sequence: GTGATCTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07H6.5. Homozygous. Outer Left Sequence: GCATCCATTCACCATTCACA. Outer Right Sequence: CGGAAAAATGTTGCACAATG. Inner Left Sequence: TCAAATAATTGCCCTTCCCA. Inner Right Sequence: TGCCCAATAAGTCAATGCAA. Inner Primer PCR Length: 3362 bp. Deletion Size: 2796 bp. Deletion left flank: AACCTAAACTTTATTGAAAATAAAAAAAAA. Deletion right flank: CACAGATCATGGAACACTATTCACACAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47B10.7. Homozygous. Outer Left Sequence: ACCAGCGCCAATGATAAAAA. Outer Right Sequence: TTTTGCATGTTGTCTACCGC. Inner Left Sequence: AGCCCGTTTGTCCTTGTAAA. Inner Right Sequence: AATTTCCTTCTCGGGTGCTC. Inner Primer PCR Length: 2288 bp. Deletion Size: 1201 bp. Deletion left flank: AAAGTTTTGAAGAAATGTAGAGTGTCGTTT. Deletion right flank: ATACTAAATAAATATGAATTAATTTTGTAA. Insertion Sequence: ACTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E4.3. Homozygous. Outer Left Sequence: AAAAGTTGCGCTTCCAAAAA. Outer Right Sequence: TCAAAACGAATCAACGACCA. Inner Left Sequence: CGCTTTTGTAGAAAAACACGG. Inner Right Sequence: TGCATCGGCATTTGTTGTAT. Inner Primer PCR Length: 3120 bp. Deletion Size: 2410 bp. Deletion left flank: TTTGAGATATCAAACGATCGGAAACTAGTA. Deletion right flank: CCGACAGTATGGAGCCGCACCACCTCCAAC. Insertion Sequence: ATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC334.2. Homozygous. Outer Left Sequence: CCATCTGACGTTGCTCAGAA. Outer Right Sequence: GGAGCATGAGCACAACTCAA. Inner Left Sequence: AGGCTCGTAGATGCCAAAAA. Inner Right Sequence: TGATCTACCTCTGCATCCCC. Inner Primer PCR Length: 2309 bp. Deletion Size: 1078 bp. Deletion left flank: TTTTAGAAGACAATTATCAGTTGAAAAATC. Deletion right flank: TTTATCAACAAACTCCTTCCGCAAGTCTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y32F6A.1. Homozygous. Outer Left Sequence: CAATCAAAATGAGTTCGGCA. Outer Right Sequence: TCCTCAACTGATAGACGGGC. Inner Left Sequence: AAATTGGCAACAGACTCAAAAA. Inner Right Sequence: TCTCGATTGAAATTCCCGAG. Inner Primer PCR Length: 3158 bp. Deletion Size: 1483 bp. Deletion left flank: CAACAATGTCTCTTGAGAATTCAAAAATCT. Deletion right flank: AAGATATTTAAATACTTTTAAAACTTTTTA. Insertion Sequence: ATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H21P03.3. Homozygous. Outer Left Sequence: TGAAAACAATGGCCAGATCA. Outer Right Sequence: TTCGTCTCGTCGAATCTGTG. Inner Left Sequence: ACGAGCACAAGTGTGTGTCC. Inner Right Sequence: TGATAAACCAGCAAGTCCCC. Inner Primer PCR Length: 1168 bp. Deletion Size: 620 bp. Deletion left flank: GAGAATTGATCCAATGAAACAGAGACGACG. Deletion right flank: GGTCAAATTTTAAAGCAAATTTTCGAAAAA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10H11.1. Homozygous. Outer Left Sequence: GCGCCGAAAAAGTACAAAAA. Outer Right Sequence: AGTAATGACGGTTTCACCGC. Inner Left Sequence: TTGTGCAGGAGAAACGTGAG. Inner Right Sequence: TGCATCGTTCTGTTTCCAAG. Inner Primer PCR Length: 3296 bp. Deletion Size: 2472 bp. Deletion left flank: GGATCGAAGAATGTCGATGTGAGACTTGTA. Deletion right flank: GTTGTGTACAAAGGAGCAGAACCTGAGCAG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y65B4A.3. Homozygous. Outer Left Sequence: ACCTCCTCAGACGACTCGAA. Outer Right Sequence: GAGCGCGAAAATTCAAAGAG. Inner Left Sequence: GTCGCCATATCGTCGTTTTT. Inner Right Sequence: CCGATTTTAGAGGAAGACCAGA. Inner Primer PCR Length: 3213 bp. Deletion Size: 1830 bp. Deletion left flank: CATGGTTTCCGACTGTTTTTCCTGTTAAAT. Deletion right flank: TTTTTTCCACATGTGTGGATCTCAATTTAT. Insertion Sequence: GTTAAAAAATGTATGAAAAAAAATTTTAAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0285.7. Homozygous. Outer Left Sequence: ATAGGCGCATTAGATGACGG. Outer Right Sequence: CATTTTCGCATTTCTCGGAT. Inner Left Sequence: TTGAACAAGAAATAACATTGAAAAA. Inner Right Sequence: CTGTGCCTGTCTCATGCCTA. Inner Primer PCR Length: 1167 bp. Deletion Size: 630 bp. Deletion left flank: ACAAATTCGCTTTCTCCACAGCCACCATCT. Deletion right flank: AGAATCTGCCTGCCTTATACCTAAATGTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01A10.2. Homozygous. Outer Left Sequence: AGCGGAGAGTGAAGTTTTGC. Outer Right Sequence: AGGAGGGTTTGCAACAAAAA. Inner Left Sequence: GCCCGATTAATAGTCTCTCCAA. Inner Right Sequence: CGGTATTTCTTAATGTTAATGCAC. Inner Primer PCR Length: 3012 bp. Deletion Size: 2391 bp. Deletion left flank: GTTAACCATCTGCCCTTACCCAGTGTCGCC. Deletion right flank: TAATAAAGATGAAATGAATGTTTCAGTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W06E11.5. Homozygous. Outer Left Sequence: GCTCTTTTTCCGACACTTGC. Outer Right Sequence: CCTCGTCGTTTGACCATTTT. Inner Left Sequence: TCTCCTTTGTCGAGAATCTGAA. Inner Right Sequence: TCATGTCAGCCACACCATTT. Inner Primer PCR Length: 3192 bp. Deletion Size: 1425 bp. Deletion left flank: AAAGTAGATATATTTTTCAAAATTTTAAAG. Deletion right flank: TTGAAAATGTTTTAGAAAATTCATAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54F7.5. Homozygous. Outer Left Sequence: CAGAAACCATTTCCCTCGAA. Outer Right Sequence: CTGAAGACACTTGCTCAGCG. Inner Left Sequence: CCACAGTCGAAGGTTTGGAT. Inner Right Sequence: TGGCAAAAGAATCATGGTCA. Inner Primer PCR Length: 3220 bp. Deletion Size: 1722 bp. Deletion left flank: GGCACAATATCAATCAGATTCTGACAAAAA. Deletion right flank: CGGTACGTGATTTAGTTGTTTTTTTTTCTC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10E9.6. Homozygous. Outer Left Sequence: AACACATGGCATTGCAAAAA. Outer Right Sequence: GCAACAGAAGGTGTACGCTG. Inner Left Sequence: TGATATCCGGACAGAGAGGG. Inner Right Sequence: CCAAGGAGTCGGTGATTTGT. Inner Primer PCR Length: 3015 bp. Deletion Size: 2263 bp. Deletion left flank: ACCCACATACCTTATACTTTATCCGAAAAT. Deletion right flank: GTGCTTGAGATATCAATCTAGATGGTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45H10.4 Homozygous. Outer Left Sequence: aacgaacgagttcaattggc. Outer Right Sequence: ggccaccgatttttcctatt. Inner Left Sequence: taaagcaatttccccacagg. Inner Right Sequence: ttacggccacatagcaaaaa. Inner Primer PCR Length: 3175. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47G4.7. Homozygous. Outer Left Sequence: AAACAGGAAAGGGGGAGAGA. Outer Right Sequence: AAGCCTTCAGATTCAAGCGA. Inner Left Sequence: CGACAAAGAGATGGGGAGAA. Inner Right Sequence: CGCACTCCAGGTCATAGACA. Inner Primer PCR Length: 3240 bp. Deletion Size: 1093 bp. Deletion left flank: GAGCGTAGACTAGGGTTTCCGTCTGCAAAT. Deletion right flank: GAACTCAACTTCTCTGTGGAATGTGTAAAG. Insertion Sequence: CAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48E1A.1. Homozygous. Outer Left Sequence: TTCAGCTTTGAAATTTCCGC. Outer Right Sequence: GCCATTTTGGGCAATAAAAA. Inner Left Sequence: CTCCGTCGTCTGATCCTCTC. Inner Right Sequence: TTCAGGAATGAGATCCCTCG. Inner Primer PCR Length: 2607 bp. Deletion Size: 1490 bp. Deletion left flank: CAGTTTCAATTCCCGCTGCCATATTTCCCT. Deletion right flank: TTTTGTCTCAGAAAATCCGCATTTTTTGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10C2.5. Homozygous. Outer Left Sequence: ACAAACACCAACAGCGATGA. Outer Right Sequence: TCAATTGCAAAAATGCTCGT. Inner Left Sequence: TTGTTGGATTTTGCTTTTACGA. Inner Right Sequence: CTCAGAATTTCCCCCAAAAA. Inner Primer PCR Length: 1134 bp. Deletion Size: 570 bp. Deletion left flank: TTGGCAGAATGTATCGGTATGAGCTATGTA. Deletion right flank: GGTTTATTGCTGAAACTTACTGAGCCGGGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C48D1.2. Homozygous. Outer Left Sequence: CAAAAGGACGCTCTGCCTAT. Outer Right Sequence: TGTCGTGTCGAGACCAGGTA. Inner Left Sequence: AGCAGATCGATTGTTGTTCAAG. Inner Right Sequence: TTGGTCCCAAAAACCAAAAA. Inner Primer PCR Length: 1118 bp. Deletion Size: 682 bp. Deletion left flank: GGCTTTCGCTCCAAAGAATATAAAATAATC. Deletion right flank: TTAAATATCAGTTTACATTAGGAACAAGGC. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57H12.3. Homozygous. Outer Left Sequence: CGCTGAGATCAGCATCAAAA. Outer Right Sequence: CAGAATGTTTTTCGCCCAAT. Inner Left Sequence: CGGAGAAAGGGGGTATGTTT. Inner Right Sequence: GGGAAATCGGGAATGAATAAA. Inner Primer PCR Length: 1158 bp. Deletion Size: 312 bp. Deletion left flank: ACTACAAACATTCCAGCGTCCACCACCACC. Deletion right flank: GAAGAAATTCCAAGAATTCAAAGAGAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807