Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS8367 C. elegans oac-22(sy1286) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-22; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACGCGTTACTTTTTGTGTCAAACAGACCAAAAA Right flanking sequence: CTGTGGCAGAGGACTATTTTACAATGgtaggtgctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTCAAACAGACCAAAAACTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616