| VC1966 |
C. elegans |
apm-1(ok2578) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F55A12.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2578 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAGGGATGACTGTTTTGGC. External right primer: ATTACGGCTTCCACGTTTTG. Internal left primer: TGGCTTGAAGGATATTGGGA. Internal right primer: ACATGTCGATTTCCGGTCTC. Internal WT amplicon: 2261 bp. Deletion size: 1825 bp. Deletion left flank: TAAAGATAATATAGAAAAAAAAAATTTCGG. Deletion right flank: AAACTCACATTTCCTTTGAGGTCCAAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1970 |
C. elegans |
gkDf42 gkDf43 I; Y47D3B(gk1197) III. Show Description
This strain is homozygous for a deletion (gk1197) in Y47D3B, detectable by PCR using the following primers. External left primer: AAACGCGAAAATGTCGAAAC. External right primer: GATGTCTTCTCCCCCTCCTC. Internal left primer: GCGTCAAATATGTCGCGTAA. Internal right primer: TTAGTAGGCGGCTTTGTGGT. Internal WT amplicon: 1949 bp. Deletion size: 233 bp. Deletion left flank: ACCCCTGGACGTTTGGGCGCGTTTTTGTCA. Deletion right flank: TTTTCAGATAGTACACACACACATAGGAAA. Validation: No CGH probes for gk1197. Other deletions (gkDf42, gkDf43) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1971 |
C. elegans |
flp-24(gk3109) III. Show Description
This strain is homozygous for a deletion (gk3109) in C24A1.1, detectable by PCR using the following primers. External left primer: AGACCACGCCTACTACTTGGC. External right primer: CCATGTTGCTTCCAGTGCCAC. Internal left primer: CGATGTTCCGCTCTGAGCTTC. Internal right primer: TGGTCACAGTGCATTGCTCTC. Internal WT amplicon: 2029 bp. Deletion size: 1180 bp. Deletion left flank: TTTCGAAAGCTTGCCGCAAAACTCTGCCAT. Deletion right flank: AGACCTAAAAATTCCGGCAAATACCACATT. Validation: gk3109 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1973 |
C. elegans |
T01C3.3(ok2482) V. Show Description
T01C3.3. External left primer: CCTGGCTGTTACCCAAGTGT. External right primer: GCTCACATGAAGTGCAGCAT. Internal left primer: CGAGAAGGGAAATTCCACAA. Internal right primer: TGTGTAGGCTCCCTAATGCC. Internal WT amplicon: 2419 bp. Deletion size: 1629 bp. Deletion left flank: TTGAACGCAACATGATTCTCATCGGTGTAA. Deletion right flank: GTAAATATACAGAGAGATTTTACGCGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1974 |
C. elegans |
F02E8.2(ok2295) X. Show Description
F02E8.2. External left primer: GACGGTGCTCATTCTTCCAT. External right primer: GAGTGGTGGATTGGGAAAGA. Internal left primer: CCAGTCCATTGCTCAATTCC. Internal right primer: CAAGCGGGTCGTTTATTTGT. Internal WT amplicon: 2195 bp. Deletion size: 1115 bp. Deletion left flank: ACTTTTATTGTGAGTTGTGCATTGCAGTTT. Deletion right flank: ACATTTTCTTTGTATTACAGTAAATTTAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1975 |
C. elegans |
H14N18.4(ok2566) V. Show Description
H14N18.4. External left primer: TTCCGAGTCTGGCTGAAACT. External right primer: GGCGGATTTGTCATGACTCT. Internal left primer: AAATTGTCGCGTTGCTTACC. Internal right primer: TGCGTAAGATATTTTCTCATAACTG. Internal WT amplicon: 1211 bp. Deletion size: 844 bp. Deletion left flank: TTAGAAAATTATTTTGAAAAGTGTTAAATT. Deletion right flank: GTTTCACGAGCATTTATAGTTTGACACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1976 |
C. elegans |
tbx-7(gk1034) III. Show Description
ZK328.8. External left primer: GCTGCTCCACCTTTTGTTTC. External right primer: ATCACAGGGTGCATCTTTCC. Internal left primer: ACCCGAACTATCAGCTCGAA. Internal right primer: GCGTATGCACTCGAAGTGTG. Internal WT amplicon: 1994 bp. Deletion size: 932 bp. Deletion left flank: ATCTACTGATATCATTTCCATTATTATTGT. Deletion right flank: TATTAGTAGATGAAAAGGAGGAAAAGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1977 |
C. elegans |
F35D2.4(ok2142) II. Show Description
F35D2.4. External left primer: CAAGAAAGCCAACAACTCCC. External right primer: TCGTTCACGAAACATTGCAT. Internal left primer: TTCAAATGAAGTCCAAGCCC. Internal right primer: GCCCTTCACAAAGCACTCTC. Internal WT amplicon: 2754 bp. Deletion size: 1217 bp. Deletion left flank: TGAGAGATAGACAAAAATTGTAACCGCTAA. Deletion right flank: AAATGGAGCAAATGGGTTCAGAGAGTCATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1978 |
C. elegans |
T24B1.1(ok2604) I. Show Description
T24B1.1. External left primer: ACCGAACTTGACGAATCCAC. External right primer: TGAACAGGACGATCACTGGA. Internal left primer: TAAAGTGTCCGATATTGCCG. Internal right primer: TCCGATTCCTTGCTGAATTG. Internal WT amplicon: 1116 bp. Deletion size: 494 bp. Deletion left flank: GTTATCACTGAAGATTTCGGCAGACCGGCT. Deletion right flank: GAAAACCAAAAAGTATCAAGTCATGAAATG. Insertion Sequence: AAAGACCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1979 |
C. elegans |
R12B2.3(gk3268) R12B2.2(gk3269) tbx-34(gk1051) III. Show Description
This strain is homozygous for a deletion (gk1051) in Y47D3A.10, detectable by PCR using the following primers. External left primer: AGTTGTGGCTTCTGCGAACT. External right primer: CACCCACTGACACCATTGAG. Internal left primer: ATGGTCAGGACGGGAATGTA. Internal right primer: TTTCTCCACTGCAACGTGAC. Internal WT amplicon: 2318 bp. Deletion size: 971 bp. Deletion left flank: TTTTTGTGCAGCAATTTTTGCGGCGGCTGA. Deletion right flank: GGTGTCAGTGAATGTAGGCAGCCATGAAGC. Validation: gk1051 passed by diagnostic PCR, CGH. Other deletions (gk3268, gk3269) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1980 |
C. elegans |
F28H6(gk1053) X. Show Description
This strain is homozygous for a deletion (gk1053) in F28H6, detectable by PCR using the following primers. External left primer: TAAATGATTGCGCCATTTCA. External right primer: TAAAAATCACCTTCCGCCAG. Internal left primer: TTCCACATCACGCAGCTTAC. Internal right primer: TTCCCTCGAATTCACATTCC. Internal WT amplicon: 2143 bp. Deletion size: 831 bp. Deletion left flank: GAGATGAATGTTATATCATTATGAGATATC. Deletion right flank: ATTTAGTTTTCAGATGGCTCCATCAAAAAG. Validation: gk1053 passed by diagnostic PCR, CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1981 |
C. elegans |
flh-3(gk1049) IV. Show Description
Y11D7A.13. External left primer: GTCGCTCCCAATTTTAACCA. External right primer: AGTGTGGACTACCTGTGGGG. Internal left primer: GCTTCGGAGACGACTGAATC. Internal right primer: AGAGGAGGAAGATTGGCGAT. Internal WT amplicon: 2128 bp. Deletion size: 1200 bp. Deletion left flank: GGAGACGACTGAATCTTCGTATTGAATCTT. Deletion right flank: TAACTTTTCAGCCTCAACAAACCAAGAACC. Validation: gk1049 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1982 |
C. elegans |
flp-25(gk1016) III. Show Description
K04H4.7. External left primer: CCTAGTGTACTTCCGTATCCG. External right primer: GTGCAGCGACTTGATAGTGAG. Internal left primer: ATAGTCAGTGAGAGACGCTGG. Internal right primer: CCGCCTTCGATCGATTTTCTG. Internal WT amplicon: 2295 bp. Deletion size: 673 bp. Deletion left flank: CGCCTATAATATAAATCCAATAAAATTTGA. Deletion right flank: GTTGAACAAGTTTTAATAAAACCAATGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1984 |
C. elegans |
cky-1(gk1052) V. Show Description
C15C8.2. External left primer: TCAACATCACCCAACTGGAA. External right primer: ACATGATGACCCTTTAGCGG. Internal left primer: CATCCTGCAGCTCAAGTGAA. Internal right primer: GCTTACACGCATGCCATAAA. Internal WT amplicon: 1542 bp. Deletion size: 195 bp. Deletion left flank: ACTATTTAAAAAAGCTGACAGTAATTTTCA. Deletion right flank: CAGTATGATTTTTCATAACAAATTAAGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1985 |
C. elegans |
F47G4.6(gk1056) I; daf-3(gk3330) X. Show Description
This strain is homozygous for a deletion (gk1056) in F47G4.6, detectable by PCR using the following primers. External left primer: CGCTTCTCCTGAGGTAGTGG. External right primer: GGACACTTCGAACCGGATTA. Internal left primer: ACGATGGATCGGTGTTTCTC. Internal right primer: AGCTGCCTAGCCTTCTCCTC. Internal WT amplicon: 1914 bp. Deletion size: 457 bp. Deletion left flank: TTAGCCTAAAAAATTTTTCCGAATTTTCTC. Deletion right flank: AGCTACCGTACTCATAAGCTACAGAGTGTA. Validation: gk1056 passed by diagnostic PCR and CGH. Other deletion (gk3330) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1986 |
C. elegans |
Y54G2A.20(gk1060) IV. Show Description
This strain is homozygous for a deletion (gk1060) in Y54G2A.20, detectable by PCR using the following primers. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 751 bp. Deletion left flank: GCCCTTAGATGCCAGAGCGGAAATTTCCAT. Deletion right flank: ATGGTTGAGAACTGACGCTTTGGATGAATA. Validation: PCR diagnostic for gk1060 equivocal. No CGH probes for gk1060. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1987 |
C. elegans |
F52C9.3(ok2530) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F52C9.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2530 homozygotes (sterile with few eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAGCAGTTGATACACAA. External right primer: TAGTTCCCTAAAACGTGGCG. Internal left primer: TTGGAACTGTTGTCACTGGC. Internal right primer: GGATGTTGGCAGGAAAATGT. Internal WT amplicon: 3134 bp. Deletion size: approximately 1000 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1990 |
C. elegans |
+/mT1 II; mup-4(ok2321)/mT1 [dpy-10(e128)] III. Show Description
K07D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2321 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATGGCAGGAATTGTTT. External right primer: GCGGTAACGGACTTTGTCAT. Internal left primer: GAAATGAGCACGGGGATTTA. Internal right primer: GCTTCTTCATGTGACTGGCA. Internal WT amplicon: 2913 bp. Deletion size: 1384 bp. Deletion left flank: TATTTTATTTGGTTTTACCTGACTCTGACT. Deletion right flank: AACAGTTTACTTAATAATCAGCTTTATTGA. Insertion Sequence: ACAGTTTACTTAATAATCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1992 |
C. elegans |
egas-2&Y69H2.3(ok2651) V. Show Description
Y69H2.12, Y69H2.3. External left primer: ACCTGCGATAGTGGATGGAC. External right primer: AAACGAGGAGTACCGGTGTG. Internal left primer: TGCGTCCCGTATAAGGATTC. Internal right primer: GGAACCCAAGAGTACACGGA. Internal WT amplicon: 3178 bp. Deletion size: 1934 bp. Deletion left flank: TGTTAGGTACAATGCACAGCCAAATGCCCA. Deletion right flank: ATCTGAGCCTATTTGAGTCGGCCTAAAGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1993 |
C. elegans |
nhr-288(gk1028) V. Show Description
Y51A2B.3. External left primer: TTCCGCTGAAATGTTTTTCC. External right primer: TCATTGAATTGTTCCTGCCA. Internal left primer: TTCTCCATATTGCCCAGACC. Internal right primer: AAATACATCCACTGGGAGCG. Internal WT amplicon: 2180 bp. Deletion size: 699 bp. Deletion left flank: TTATTCGAATTTTCAATTTTCATATAATTA. Deletion right flank: GAAACCCATTTTCATAGAAATTCTCCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1994 |
C. elegans |
ncbp-2(ok2496) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26A3.2. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2496 homozygotes (probably viable Dpy, sometimes blistered, often sterile). Use care when maintaining - viable WT non-GFP animals are most likely rare recombinants. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAATTTTCACCTGCCTCA. External right primer: AAGGAATAAGGGGGTCATCG. Internal left primer: GCATGCAGCACTAATTTCCA. Internal right primer: TGTAGTCCAACATTGGCGAG. Internal WT amplicon: 2328 bp. Deletion size: 1024 bp. Deletion left flank: AAAAGTTGTTAAAACAAAAGGCTTACCTGG. Deletion right flank: GACAAAAGGATAAAGTCGACATTTTTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1995 |
C. elegans |
T12A2.15(ok2509) III. Show Description
T12A2.15. External left primer: ACTGGTTATCGAAATGCGGA. External right primer: ACAACAAATGTCGGACGTGA. Internal left primer: TCCTTATTTCCATCCAACGC. Internal right primer: ATGGTTGGTGGAGTCTCTGG. Internal WT amplicon: 3157 bp. Deletion size: 1090 bp. Deletion left flank: TTCTTGGGTTCGGGGTTTCTGATCGTTTTG. Deletion right flank: GATTTCCGCGTACGGATCTGATTTTCCCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1996 |
C. elegans |
T08B2.4(ok2534) I. Show Description
T08B2.4. External left primer: ATTTCAACAAGAACCGCTGG. External right primer: ACACGAGTTCATATTCCGGC. Internal left primer: ACGCGCATCAGTTACAAGAA. Internal right primer: AGCCTATATCTCCGTGCGAA. Internal WT amplicon: 1244 bp. Deletion size: 478 bp. Deletion left flank: GCCCTGGCAAGGCGATGTGGAGTTGAAGAT. Deletion right flank: TGTTTTTCTTCTACTTTTGAAATTGCTCCA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1997 |
C. elegans |
F40F11.2(ok2621) IV/nT1 [qIs51] (IV;V). Show Description
F40F11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2621 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATCTGCACAGCCTTCTCAA. External right primer: GAGCAGGTCTACCCTTCACG. Internal left primer: AGATAATGCCACCACAGGCT. Internal right primer: TGTTGAAGCAGGTGGAATTG. Internal WT amplicon: 3165 bp. Deletion size: 2394 bp. Deletion left flank: AGGAATCAATGCAATATGGTCACCAACAGA. Deletion right flank: AAGTTGCATGTTAAGATAAAAGCTTCACCA. Insertion Sequence: CATATAATAAGTACAATACATACAATATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1998 |
C. elegans |
C25H3.11(ok2632)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C25H3.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP o2632 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTGTTGAGCTTTGTTCCCA. External right primer: AAATCGATGAAAATTCCGCA. Internal left primer: AATCAACGCTCACTCGCTCT. Internal right primer: GGAATTCGAAAACCACGATG. Internal WT amplicon: 3051 bp. Deletion size: 1740 bp. Deletion left flank: CTCTCCTGGTTCCCATATTGTAGTTGGACG. Deletion right flank: ACTGTGTCATCTGATGCCTCGTCAATTCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1999 |
C. elegans |
eif-3.E(ok2607) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0511.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2607 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATCTCCGTGTTTGCCACA. External right primer: GATGAGAAATCCCTGACCGA. Internal left primer: TCGCCTTGACTTTGTCTTGA. Internal right primer: GACTCCGTTGTTGCCATTTT. Internal WT amplicon: 1140 bp. Deletion size: 578 bp. Deletion left flank: GTTCAGCTTCCTCTTGGCTCATATTCAATC. Deletion right flank: CCATTCTTGGAGCAGAATTTCACTGGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2000 |
C. elegans |
mca-1(ok2532) IV/nT1 [qIs51] (IV;V). Show Description
W09C2.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2532 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGGTTAGAAGCTGACGAGCG. External right primer: TGAATCCGATCCAGTTCTCC. Internal left primer: CAGTCGGCAGATTTCACAGA. Internal right primer: CCGGAAAAATGCTCATCACT. Internal WT amplicon: 3166 bp. Deletion size: 1418 bp. Deletion left flank: TCGCGGATTCTCTCATTGAATTCCTTTCCT. Deletion right flank: ACTTTTCCATTTTCGTCGCGGATTCTCTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2003 |
C. elegans |
+/szT1[lon-2(e678)] I; mIs12 II; sec-3(ok2238)/szT1 X. Show Description
F52E4.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation, and homozygous for unlinked pharyngeal GFP insertion mIs12 (artifact of strain construction). Balanced lethal heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2238 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.External left primer: CAATCTTCGAGCCTGGGTAA. External right primer: TACCTTCCAGTCCAGATGCC. Internal left primer: TGAAATGGCGATTTTGATGA. Internal right primer: CATGATATGGCGATGCAAAG. Internal WT amplicon: 2918 bp. Deletion size: 1120 bp. Deletion left flank: TTTCTCCATACTACGTCCTCCGAGACTTGA. Deletion right flank: AATGAAACGATTTCCTCGTTGAGACGTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2004 |
C. elegans |
+/szT1 [lon-2(e678)] I; C03F11.3(ok2598)/szT1 X. Show Description
C03F11.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2598 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGACAAGGCAATGAGACC. External right primer: TGGGAGCTTTAATCGAAGGA. Internal left primer: GCCAAGTCCAACAGCTATCC. Internal right primer: CAATTGCTCTTTTCGGGCTA. Internal WT amplicon: 1231 bp. Deletion size: 302 bp. Deletion left flank: GTAAATCCCCATTGCAAACAAAAAAAGTGT. Deletion right flank: CAGTACGTTTTATTAGCGTAGGGCCACCTA. Insertion Sequence: ACCAACGCCGAGTTCGGGTCCTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2005 |
C. elegans |
ZK973.9&lpd-5(ok2652) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK973.10, ZK973.9. Homozygous lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2652 homozygotes (late larval arrest or sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTTGAGGCTGTTGTTGGTT. External right primer: GAATCGGCGCTACTCATCTC. Internal left primer: GCAGCGGTACCATCATCTTT. Internal right primer: TTACAACGGGAGACAAAGGG. Internal WT amplicon: 2218 bp. Deletion size: 1384 bp. Deletion left flank: ACTCCTTTTTTGCAAAAAAAAACAAACAAA. Deletion right flank: TGCTTGTACGAGAACACATACCATTCCCTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2006 |
C. elegans |
K09A11.1(gk1064) X. Show Description
K09A11.1. Identified by PCR, validated by CGH. External left primer: GAGCAACGAAATTTTGGGAA. External right primer: GTTATGTTTGCCGCGAGATT. Internal left primer: GGAGTATCCGTCCGCAATAG. Internal right primer: TGCAGCTCTCTTTCCATGTG. Internal WT amplicon: 2161 bp. Deletion size: 810 bp. Deletion left flank: TTTGTTCTCCACTCTTTATTCGTATTGAAT. Deletion right flank: GTACGAAGACCAACTAAGAATGGAATTGAA. Insertion Sequence: CTTATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2007 |
C. elegans |
nhr-185(gk1066) V. Show Description
This strain is homozygous for a deletion (gk1066) in F47C10.1, detectable by PCR using the following primers. External left primer: TCATTCTGGCAGGAAATTCA. External right primer: GGCGTAACGAAGTCCGATAA. Internal left primer: TCCGGTTAGTCCTGCAATTC. Internal right primer: CTGCTACCCATGTCGAGTGA. Internal WT amplicon: 2231 bp. Deletion size: 1770 bp. Deletion left flank: TTGCAAATTGAACATTGTGTGAAGCTGAGC. Deletion right flank: ATTGAATAGAACAATTTGGTACTAATTGAA. Validation: gk1066 passed by diagnostic PCR and CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2009 |
C. elegans |
F58G11.6(ok2182) V. Show Description
F58G11.6. External left primer: TGTGAGCGTTCAAATTCTGC. External right primer: TGTCGAAAATCGTGTGGAAA. Internal left primer: AATAAATCGAGACATGCGCC. Internal right primer: GTGGAGCCCAACATGTTTCT. Internal WT amplicon: 2872 bp. Deletion size: 1047 bp. Deletion left flank: CGAAATAATTATGTTTTTACAGATGTCCTT. Deletion right flank: ATTAGAAATCAGAAGGGATTCTGGTGAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2011 |
C. elegans |
Y48G10A.3(ok2508)/hIn1 [unc-101(sy241)] I. Show Description
Y48G10A.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATGGTTTTCGCAGTTT. External right primer: TGACATGCAGCCTCTAATGG. Internal left primer: ATTCTGCGTCTCCTGCATCT. Internal right primer: AAAAGTGAACACGGCCTTTG. Internal WT amplicon: 2246 bp. Deletion size: 1628 bp. Deletion left flank: AAAAGAGCATCATGCTCTCCGTCACAGCGT. Deletion right flank: TTTTAAAAAAGTTTTGGTTTTTTTTTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2012 |
C. elegans |
flp-27(gk3331) Y17G7B.22(gk1062) II; gkDf45 X. Show Description
This strain is homozygous for a deletion (gk1062) in Y17G7B.22, detectable by PCR using the following primers. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1412 bp. Deletion left flank: AAATAGACTATTTCGGAAAATGGAAATGAG. Deletion right flank: AAAATTATTGATTTTGACCCCAAAAATTTA. Insertion Sequence: TTGT. Validation: gk1062 passed by diagnostic PCR and CGH. Other deletions (gk3331, gkDf45) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2013 |
C. elegans |
snr-3&rsp-5(ok2084)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T28D9.10, T28D9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2084 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGTTCCGCAAAGTGCATAAT. External right primer: CTAGGAAGAGCGCGAACAAC. Internal left primer: GTTGACTCGGAAAGCCGTAA. Internal right primer: AGGAAGCGGTGTCCTACTCA. Internal WT amplicon: 3125 bp. Deletion size: 1493 bp. Deletion left flank: AGTATAGGACGTTCGATACTCAAATTTGCT. Deletion right flank: CGTGATCGCAAACGTTCTCGCAGATCCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2016 |
C. elegans |
flp-18(gk3063) X. Show Description
Y48D7A.2. External left primer: TGTGCCACTCACCGATGACAC. External right primer: CATCATCATGGCGCTACG. Internal left primer: GTCCTATCAGTACCTCATGGG. Internal right primer: CGAATACCTTGTACACGC. Internal WT amplicon: 2980 bp. Deletion size: 1312 bp. Deletion left flank: AACACACGTCAACCATGAACAAATCTGCTT. Deletion right flank: AAATTTCAAATTCATGCTTTCAAATCGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2017 |
C. elegans |
C06B8.7(ok2521) V/nT1 [qIs51] (IV;V). Show Description
C06B8.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2521 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Note that ok2521 was subsequently isolated as a viable homozygote (VC2085), so the lethality in this strain is not a consequence of the deletion. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 540 bp. Deletion left flank: AGCCAACGGCATGCTGGTTATGCTCACCTT. Deletion right flank: TGTGACTTAAGACTTTCTGGCAATGATTCT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2018 |
C. elegans |
F16D3.4(ok2634) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F16D3.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2634 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCGGGAGATTCAAATAAGG. External right primer: TTTTGCAGCAATGGATGAAG. Internal left primer: CAAAACGCGTCTCCATTTTT. Internal right primer: ATGCACCAGTCGATGAGTCG. Internal WT amplicon: 1161 bp. Deletion size: 464 bp. Deletion left flank: CCGTCAAAACTCTCCGATCAACGTGTTTGA. Deletion right flank: CGTACAATACACAAATCAGAAAGATATTTC. Insertion Sequence: CAAATACACAAATCAGAAAGATATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2019 |
C. elegans |
B0336.3(gk910) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0336.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk910 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTACCCCATTGGTTCCTCCT. External right primer: TCAATTCCATCTCGAGGTCC. Internal left primer: ATTCTCGCATTTCTTTGCGT. Internal right primer: ATTTGGGCTGCAATCTCATC. Internal WT amplicon: 2166 bp. Deletion size: 408 bp. Deletion left flank: ATGGTTCCACTCCCGGCTACCGCTCCTAAT. Deletion right flank: CTTCAAGTTGCCAAGATTCCACCAGAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2024 |
C. elegans |
ZK616.6&ZK616.4(ok2654) IV/nT1 [qIs51] (IV;V). Show Description
ZK616.4, ZK616.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2654 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTCTGTCCCATGTCTGCTC. External right primer: TGTTACAATTTGATGGCGGA. Internal left primer: CGGAATTCAAAATCCTGGAA. Internal right primer: TTCAGGGGTTCTCTTGGTTG. Internal WT amplicon: 3222 bp. Deletion size: 1966 bp. Deletion left flank: AAGACCGATTGCTCCGAGGTTTCCAAGGCA. Deletion right flank: TACAAGTATTGATATGGACTACGTCGACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2026 |
C. elegans |
Y43C5A.3(ok2583) IV/nT1 [qIs51] (IV;V). Show Description
Y43C5A.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2583 homozygotes (sterile adults). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACCGATTCAGAGGCATTTT. External right primer: CAATACGTGCGTTGGTTGTC. Internal left primer: AGAAGAACGTGCCTGCAAAT. Internal right primer: GCTTCCAAGTCCTCCGTGTA. Internal WT amplicon: 2237 bp. Deletion size: 1427 bp. Deletion left flank: CCCCGTCTGAGACCCTTTCCATTTTTCAAT. Deletion right flank: AAAACATCAATACCTCCGGAAATATATCAT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2027 |
C. elegans |
nhr-87(gk1283) IV. Show Description
Y41D4B.7. External left primer: GAAACCACAAATTACCCCCA. External right primer: AACCACATTTCGGCTGTTTC. Internal left primer: CACTTCATAGTGTGGGCGTG. Internal right primer: AGGATTCCGATTGACCTTCC. Internal WT amplicon: 2253 bp. Deletion size: 1371 bp. Deletion left flank: AAGTGACGTCACACTTCATAGTGTGGGCGT. Deletion right flank: ATAACTTACAGAGTGATGAAAGGAACGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2028 |
C. elegans |
lntl-1(ok1824) IV. Show Description
C31H1.6. External left primer: CCAAAGTCTCCTGCCCATTA. External right primer: ACATACCACCCGCTTTCTTG. Internal left primer: TTCAAACAATGATACCCGCA. Internal right primer: TTTTGAGGGAAATGCGAAAC. Internal WT amplicon: 2666 bp. Deletion size: 1550 bp. Deletion left flank: TTACAGGTCCATCAAAGCGGAATCCTTTAG. Deletion right flank: TTTTTGTTCAGGAAACTTTGAAACGCACAT. Insertion Sequence: TACGGACCTCGTTTGAATTTCAATCATCTTCATCAGCAACAACAGTTGCAGTGAGTTTT TGGGAAAATTTTTTTGAAAGTATAAATATTCGTTTTAGTTCAACAATCATTCCTTCGGA GTATCTCGGAGACAAGTCAGGATTTGAGTCCAGGTAAGGGATGAAGAAGGCAATTCCAA AAAATTTTTAAACAAAAAACGACTGTTTCACGGTGCTATTATAACAAAACCATATGAAT GTGATTTGGTTCGAACCATGCCTTTGCCATTTTTAAAACATCATTATAAATAGTTCTGC AAATTAATATTACAGAACTCTTCCATCGGAATCTATTATGTCAGCCAACAGCAGCAGTC TTGGATCTCACTGGAAGAGAATTGATTCGTTCACTAGTGGAAAATCTACCCAATCAATT CCCACTACAATTTCTTCGAAACCTCTAACTATTCCTTCATCGATTTCTGCCAACACCGC TTCCATCCCACCAAATCATGGTTCAGAATTTTCGAAAGATTTCAAGATGTCATCCTCAT CGAGCATGACTAGTGAGTATTCGGAAACCATCCATGGAAACTCGTTGGCATCTCTGGCT CCATCGTCACAAATATTGAGCTCTTTGGTTGAAACTACTGAGAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2031 |
C. elegans |
R07E5.1(ok2653) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R07E5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2653 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTTTTGGGCCATTTTGAG. External right primer: CCATTTTCACAGCGGCTAAT. Internal left primer: AATTAATTTTTCCAGGCGGC. Internal right primer: CACAAATTTCGAAGCCATCA. Internal WT amplicon: 1186 bp. Deletion size: 399 bp. Deletion left flank: ATTTGCTAAAGTTTGAGTTTACGGGTTTTT. Deletion right flank: CTGTCTGGGAGTGGGAGTGGGAAAAGAAAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2033 |
C. elegans |
F49E12.6(gk896)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F49E12.6. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk896 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 1777 bp. Deletion left flank: GTTTTGGGAATAAAGCATCTCACAAATAAA. Deletion right flank: CGAATCTACGATATTGTCAATGTAATGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2035 |
C. elegans |
K12H6.12(gk1058) II. Show Description
This strain is homozygous for a deletion (gk1058) in K12H6.12, detectable by PCR using the following primers. External left primer: CTGCGTCTCTCACTTTTCCC. External right primer: CTTCGTTGCAGACACTTGGA. Internal left primer: GGAGGAGAACAATGGCTCAA. Internal right primer: AGCTGAGTAACGGCGATTTG. Internal WT amplicon: 2398 bp. Deletion size: 1627 bp. Note: Internal right primer binding site deleted in gk1058. Deletion product from nested PCR runs at about 1150 bp. Deletion left flank: AATTATAATCATGTGGCGAAGCACATGAAA. Deletion right flank: AAATCAATATTTTCCATTGTTCTTGATGCT. Insertion Sequence: CTTTGAAAATATTTGAATTTAGCGGGAAATTCAAAATTTTTTGAGAAAAAGCTTTGGCG GGATTTTCAAAATCTTTGAAAAAAAAACACATTTCGGCGGGAATTTCAAATTTCCTGAC AAAGCTCTTCGGCGGTAAAATACCATTTTTTTCAGAAAATTTTCGATTAAAGAATTAGG ATTAAATTTTTTAAGAAAAAAAAGCAGT. Validation: PCR, CGH diagnostics for gk1058 equivocal. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2036 |
C. elegans |
unc-53(gk3156) II; gkDf26 V; hlh-19(gk1069) X. Show Description
T04H1.1, F45E10.1, F57C12.3, T04H1.3, T04H1.2. The gk1069 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AAGGAACCTGCGGGATAACT. External right primer: CTTCCAGTAGGCAGTCAGGC. Internal left primer: CTGCTCCTCTTCCACGAGAC. Internal right primer: CCTTGTGTCCGAGTCCTCAT. Internal WT amplicon: 2234 bp. Deletion size: 716 bp. Deletion left flank: AATTGGTTTTTTTGATAAAGTTTGATTAGT. Deletion right flank: TTTCCAATATTTCATCAATTATTTGAACGC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2037 |
C. elegans |
C46F11.3(gk1070) III. Show Description
C46F11.3. External left primer: AGCAAAAGAATTGGCGAAGA. External right primer: CGATACCTCCAGATCCTCCA. Internal left primer: TATCACCAGGTGTGCATTGG. Internal right primer: AACTCCTTGACGCCAGACAT. Internal WT amplicon: 1888 bp. Deletion size: 971 bp. Deletion left flank: AAATCAGGCGTTGATCCCATAGGACTAAAA. Deletion right flank: TTTTAAACTCTTCGCGCGCTGAAAAAGGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2039 |
C. elegans |
F59C6.2(gk1013) I. Show Description
F59C6.2. External left primer: AATGAGCTTGTTTGGATGGG. External right primer: GCTTCGAGGAAGAAACGAGA. Internal left primer: GCACAACCAGAGAGAAAGGC. Internal right primer: CCATCTCACCAAGCCCTAAC. Internal WT amplicon: 1657 bp. Deletion size: 375 bp. Deletion left flank: GATGCATTTGAACCTTTCTAACTTCTCAAA. Deletion right flank: GTGGTTTTTTATATTGAGTTTTTTTGGTTG. Insertion Sequence: CTTCATCATGTGCAACAGATGTCATCGCCTTCCACCACGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|