Search Strains

naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.

naIs7 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+)]. Does not express ceh-22p::GFP, but unc-119 is rescued.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.

mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.

mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.

mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.

mgTi1 [rpl-28p::skn-1a::GFP::tbb-2 3'UTR + unc-119(+)] I. Expresses SKN-1A with C-terminal GFP tag. Reference: Lehrbach NL & Ruvkun G. Elife. 2016 Aug 16;5. pii: e17721

mgIs77 [rpl-28p::ub(G76V)::GFP + unc-119(+) + myo-2p::mCherry] V. Reference: Lehrbach NJ, et al. Cell. 2019 Apr 18;177(3):737-750.e15.

gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42]. Pan-neuronal amyloid beta1-42 expression. Impaired neuromuscular and sensorimotor behavior. See GRU101 for wild-type control strain. Reference: Fong S, et al. Sci Rep. 2016 Sep 22;6:33781. doi: 10.1038/srep33781.

arSi159 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 (II). The first intron of GFP was replaced with a Flexon containing two loxP sites. High level GFP::H2B expression requires Cre expression from a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.

aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST]?II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi26 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi31 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi27 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7s::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7s in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi36 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7f::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Express GFP::H2B in germline and early embryos. Might still carry unc-119(ed3) in background. Reference: Zeller P, et al. Nat Genet. 2016 Nov;48(11):1385-1395. doi: 10.1038/ng.3672. PMID: 27668659.

xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. gwIs59 [pha-4::mCherry::256xLacO::4xLexA + unc-119(+)]. Superficially wild-type. Express ubiquitous EMR-1::mCherry at the nuclear periphery. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red intestine (all stages) and green intestine (from late L4 stage). Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.

bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP_D5 + unc-119(+)] IV. ygIs2 [baf-1::GFP::lmn-1(Y59C) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1 (Y59C mutation). Might still carry unc-119(ed3) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.

opIs263 [rpa-1p::rpa-1::YFP + unc-119(+)]. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Express RPA-1::YFP in both germline and somatic tissues. Reference: Padeken J, et al. Genes Dev. 2019 Apr 1;33(7-8):436-451. PMID: 30804228

lsIs17 [pie-1p::GFP::pcn-1(W03D2.4) + unc-119(+)]. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Express GFP::PCN-1 in dividing cells of germline, embryos and larvae. Reference: Padeken J, et al. Genes Dev. 2019 Apr 1;33(7-8):436-451. PMID: 30804228

gwIs28 [myo-3::mCherry + 256xlacO + unc-119(+)]. Superficially wild-type. Contains a small lacO array co-integrated with a muscle specific mCherry reporter (~10x smaller than the gwIs4 array). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs34 [myo-3::mCherry + 256xlacO + unc-119(+)] III. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. ygIs2 [baf-1::GFP::lmn-1(Y59C) + unc-119(+)]. caIs3 [pha-4::lacZ + rol-6(su1006)]. Rollers. Strain expressing low level of GFP::LMN-1 (carrying the Y59C mutation). Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Mattout A, et al. Curr Biol. 2011 Oct 11;21(19):1603-14. doi: 10.1016/j.cub.2011.08.030. PMID: 21962710

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Slow growing and dumpy. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676

isIs17 [pGZ295 (pie-1p::GFP::pcn-1(W03D2.4)) + pDP#MM051 (unc-119(+))] Maintain at 25C if possible to avoid possible germ line silencing. The entire coding sequence of PCNA (PCN-1, W03D2.4) was PCR-amplified and the resulting fragment cloned into pie-1::GFP germline expression vector to generate pGZ295, which was co-bombarded with pDP#MM051, which carries an unc-119 cDNA. The transgenic line behaves as though the two plasmids have been jointly integrated.

rtSi1 [sod-1p::sod-1(WT) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. Superficially wild-type. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.

rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752

emcSi70 [unc-119p::TIR1::mRuby] (IV: -0.05). TIR1 expression driven by the unc-119 promoter, allowing degradation of AID-tagged proteins specifically in neurons. Reference: Sabatella M, et al. Cell Rep. 2021 Jan 12;34(2):108608. PMID: 33440146

emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). TIR1 expression driven by the myo-3 promoter, allowing degradation of AID-tagged proteins specifically in muscles. Reference: Sabatella M, et al. Cell Rep. 2021 Jan 12;34(2):108608. PMID: 33440146

goeIs240 [hsp-16.2p::flp-11::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Likely intergrated into LG I or LG III. Heat shock-induced over-expression of FLP-11 neuropeptide causes behavioral quiescence. Reference: Turek et al. eLife 2016;5:e12499.

goeIs247 [ceh-24p::GCaMP6s::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter expresses calcium sensor GCaMP6s with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.

goeIs257 [nas- 38p::d1mGFP::nas-38 3'UTR + unc-119(+)]. Destabilized GFP expressed from the nas-38 promoter; especially visible in hypodermis and excretory system. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs288 [flp-11p::mKate2::unc-54 3'UTR + unc-119(+)]. Low copy number insertion. Integration site unknown, but likely not in LG II. Reference: Turek et al. eLife 2016;5:e12499.

goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs388 [hsp-16.2p::cnc-1::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-1::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs397 [hsp-16.2p::cnc-10::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-10::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs407 [hsp-16.2p::cnc-2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-2::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791