| VC1656 |
C. elegans |
nhr-13(gk796) V. Show Description
Y5H2B.2. External left primer: CCCAGTGGAATGCAACTTTT. External right primer: TTGCATTCTCCTCGTAGCCT. Internal left primer: CGAGTGGAATTCTGAGAGCA. Internal right primer: CGAGACGGTAGCAGAAGACC. Internal WT amplicon: 2106 bp. Deletion size: 320 bp. Deletion left flank: TTTGCATTTATTTGCGTTTTTTTGGCTATA. Deletion right flank: TCAGTGTATTGACCAACCGGATGCCTGTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC4297 |
C. elegans |
Y71H2B.2(gk5380[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2972 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AACAATCGAGAAATGCTAATCAAAAGAAAA. Right flanking sequence: TGGCAAACGAAGAGCAGCTCGCCACCGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7211 |
C. elegans |
mrpl-40(hd7198[LoxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + LoxP])/ oxTi731 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] III. Show Description
Maintain by picking viable fertile GFP+ and Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III+. Apparent homozygous lethal or sterile deletion stabilized over oxTi731. Heterozygotes are wild-type GFP+ and tdTomato+ and segregate wild-type hereozygotes (GFP+ tdTomato+), hd7198 homozygotes (GFP+), oxTi731 homozygotes (tdTomato+), and occasional hd7198 oxTi731 recombinants. Derived from parental strains VH7198 and EG7887. hd7198 is a deletion of 1473 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACCCGCCAAATTCATCAAACAATTCCCG; Right flanking sequence: CGGCGACTACATTGATACTACGAGAAATTG. sgRNA #1: CATAAAAACCGAGGAGCCGG; sgRNA #2: CGAAACTACGAGGCTCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VT3118 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3136 |
C. elegans |
unc-119(ed3) III; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3145 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3178 |
C. elegans |
unc-119(ed3) III; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| WH468 |
C. elegans |
sep-1(e2406) I/hT2 (I;III); ruIs32 III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
|
|
| WRM1 |
C. elegans |
sprSi1 II; unc-119(ed3) III. Show Description
sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
|
|
| WRM10 |
C. elegans |
sprSi10 II; unc-119(ed3) III. Show Description
sprSi10 [mex-5p::MODC PEST::GFP::H2B::atg-4.2 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM12 |
C. elegans |
sprSi11 II; unc-119(ed3) III. Show Description
sprSi11 [mex-5p::MODC PEST::GFP::H2B::cul-4 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM17 |
C. elegans |
sprSi13 II; unc-119(ed3) III. Show Description
sprSi13 [mex-5p::MODC PEST::GFP::H2B::ets-4 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM18 |
C. elegans |
sprSi14 II; unc-119(ed3) III. Show Description
sprSi14 [mex-5p::MODC PEST::GFP::H2B::hbl-1 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM19 |
C. elegans |
sprSi15 II; unc-119(ed3) III. Show Description
sprSi15 [mex-5p::MODC PEST::GFP::H2B::lin-26 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM2 |
C. elegans |
sprSi2 II; unc-119(ed3) III. Show Description
sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
|
|
| WRM22 |
C. elegans |
sprSi16 II; unc-119(ed3) III. Show Description
sprSi16 [mex-5p::MODC PEST::GFP::H2B::mbk-2 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM24 |
C. elegans |
sprSi17 II; unc-119(ed3) III. Show Description
sprSi17 [mex-5p::MODC PEST::GFP::H2B::mex-3 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM27 |
C. elegans |
sprSi19 II; unc-119(ed3) III. Show Description
sprSi19 [mex-5p::MODC PEST::GFP::H2B::set-6 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM3 |
C. elegans |
sprSi3 II; unc-119(ed3) III. Show Description
sprSi3 [mex-5p::GFP::histone-H2B::glp-1 3'UTR + Cbr-unc-119(+)] II. Fluorescence in the distal germline and in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
|
|
| WRM30 |
C. elegans |
sprSi20 II; unc-119(ed3) III. Show Description
sprSi20 [mex-5p::MODC PEST::GFP::H2B::usp-14 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM5 |
C. elegans |
sprSi5 II; unc-119(ed3) III. Show Description
sprSi5 [mex-5p::MODC PEST::GFP::H2B::glp-1 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
|
|
| WRM6 |
C. elegans |
sprSi6 II; unc-119(ed3) III. Show Description
sprSi6 [mex-5p::MODC PEST::GFP::H2B::glp-1 (GBM UtoC) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
|
|
| WRM7 |
C. elegans |
sprSi7II; unc-119(ed3) III. Show Description
sprSi7 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
|
|
| WRM79 |
C. elegans |
mex-3(spr9[*tn1753]) I; sprSi1 II; unc-119(ed3) III. Show Description
Homozygous fertile, nearly fully penetrant embryonic lethal phenotype at 25C. sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Derived by crossing parental strains WRM52 and WRM1. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
|
|
| WRM8 |
C. elegans |
sprSi8II; unc-119(ed3) III. Show Description
sprSi8 [mex-5p::MODC PEST::GFP::H2B::glp-1 (3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
|
|
| WRM80 |
C. elegans |
mex-3(tn1753[gfp::3xflag::mex-3]) I; sprSi1 II; unc-119(ed3) III. Show Description
sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. Homozygous fertile. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Derived by crossing parental strains DG4269 and WRM1. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
|
|
| WRM9 |
C. elegans |
sprSi9II; unc-119(ed3) III. Show Description
sprS9 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' 3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
|
|
| XA3501 |
C. elegans |
unc-119(ed3) ruIs32 III; ojIs1. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Stable expression of GFP::histoneH2B and GFP::beta-tubulin when grown at 16-25C. ruIs32 contains plasmid pAZ132. ojIs1 is not on LG I, II, or IV.
|
|
| XA3502 |
C. elegans |
unc-119(ed3) III; qaIs3502. Show Description
qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Relative stable expression of YFP::LMN-1 when grown at 24C. Expression of CFP::H2B is silenced. qaIs3502 is presumably not on LG III. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de
|
|
| XIL9164 |
C. elegans |
daf-3(thu164[daf-3::SL2::mCherry::H2B]) X. Show Description
SL2::mCherry::H2B was inserted at the 3' end of the endogenous daf-3 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9172 |
C. elegans |
Y53G8AR.9(thu172[pes-1::2A::NeonGreen::H2B]) III. Show Description
2A::NeonGreen::H2B was inserted at the 3' end of the endogenous pes-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| YQ243 |
C. elegans |
unc-119(ed3) III; atg-18(gk378) V; wfIs232. Show Description
wfIs232 [app-1p::mCherry::H2B::unc-54 + unc-119(+)]. mCherry::H2B expression in the nuclei of intestinal cells. YQ243 can serve as a control strain for YQ95. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.
|
|
| ZZY655 |
C. elegans |
zzyIs139 II; zuIs178; stIs10024. Show Description
zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)] II. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. The membrane-specific PH(PLC1delta1) domain, labeled with mCherry, is expressed in all cell membranes. Derived by crossing parental strains carrying unc-119(ed3) and unc-119(tm4063). Unknown if either unc-119 mutation is still present in background. Reference: Cao J, et al. Nat Commun. 2020 Dec 7;11(1):6254. doi: 10.1038/s41467-020-19863-x. PMID: 33288755.
|
|
| ZZY861 |
C. elegans |
unc-119(tm4063) III; ltIs44 V; stIs10024; zuIs178; zzyIs139. Show Description
ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] V. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)]. Reference: Zhao Z, et al. https://doi.org/10.21203/rs.3.rs-4664717/v1
|
|
