| RB1280 |
C. elegans |
F15B9.4(ok1296) V/nT1 [qIs51] (IV;V). Show Description
F15B9.4 Heterozygotes are WT and GFP+. Outer Left Sequence: gactcaaggcgattgctgat. Outer Right Sequence: tgacgcggtaataaatgcaa. Inner Left Sequence: cgatcgttcccctcaaagta. Inner Right Sequence: ttcttgttgcgatgaagtcg. Inner Primer PCR Length: 3243. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1282 |
C. elegans |
C25E10.11(ok1380) V. Show Description
C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1284 |
C. elegans |
C30F12.6(ok1381) I. Show Description
C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1285 |
C. elegans |
lys-7(ok1384) V. Show Description
C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1286 |
C. elegans |
lys-7(ok1385) V. Show Description
C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1287 |
C. elegans |
VZC374L.1(ok1386) X. Show Description
VZC374L.1 Homozygous. Outer Left Sequence: tttgcttttcgaggcatttt. Outer Right Sequence: tgaatcagcaagattgacgg. Inner Left Sequence: gcgtaaatttccggttacga. Inner Right Sequence: tcaagctctctgctcgactg. Inner Primer PCR Length: 2166. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1288 |
C. elegans |
C48C5.1(ok1387) X. Show Description
C48C5.1 Homozygous. Outer Left Sequence: ttgccttgcattcaattgtc. Outer Right Sequence: tgctgaatgagcttcttgga. Inner Left Sequence: agtcattcggaaagcgaaaa. Inner Right Sequence: agcagatgaagaaagccgaa. Inner Primer PCR Length: 2844. Estimated Deletion Size: about 1200 bp. Breakpoint data provided by Neline Kriek 10/2004: GATACAGGTTTTAAGAAAACACCACTTGAAAAACGCAGACAACGTAAGATTTAAAACAT GACTCGTTbreakpointAGTCTAGTGGTCTAGTGAACCAGTTTGCAATTTATGGTTTG AATATTTTAATTACTTTTAATAGTTTGTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1289 |
C. elegans |
C43C3.2(ok1388) X. Show Description
C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTT GTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAG CTAATCGCAATACGTAAGTTGTTATCATTCAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1290 |
C. elegans |
npp-14(ok1389) I. Show Description
C03D6.4 Homozygous. Outer Left Sequence: ccaccaaaaagccatgaact. Outer Right Sequence: aatcggaaaatttggtgctg. Inner Left Sequence: cttcggtgcaaacggattat. Inner Right Sequence: attcgctgggaaaaattgtg. Inner Primer PCR Length: 3334. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1291 |
C. elegans |
C05D10.1(ok1390) Show Description
C05D10.1 Homozygous. Outer Left Sequence: gcctccctcattcattttca. Outer Right Sequence: atcgggtggtctgttttgag. Inner Left Sequence: aataaaatttgccgctgtgg. Inner Right Sequence: gtcccgagttgttgtcgttt. Inner Primer PCR Length: 3047. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1292 |
C. elegans |
aex-3(ok1391). Show Description
C02H7.3 Homozygous. Outer Left Sequence: gtcaacgcgtgaaaaactga. Outer Right Sequence: cagcgtgacagatgcagatt. Inner Left Sequence: gctggagagtaaagttgccg. Inner Right Sequence: ccggtttcttgtagacccaa. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1293 |
C. elegans |
C35E7.1(ok1392) I. Show Description
C35E7.1 Homozygous. Outer Left Sequence: gctcaagaaagccaatggag. Outer Right Sequence: catggagtttgctcgtctga. Inner Left Sequence: atgagcaagttgccgagagt. Inner Right Sequence: gtgggagtactgtaggggca. Inner Primer PCR Length: 2849. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1294 |
C. elegans |
C49G7.8(ok1393) V. Show Description
C49G7.8 Homozygous. Outer Left Sequence: gccaaactttgctaacgctc. Outer Right Sequence: ttagccgaagtagccgaaaa. Inner Left Sequence: aagccttcagacacgctttc. Inner Right Sequence: gaccgattgattttagccga. Inner Primer PCR Length: 2372. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1295 |
C. elegans |
F10C1.5(ok1394) II. Show Description
F10C1.5 Homozygous. Outer Left Sequence: acacacccagaagaccatcc. Outer Right Sequence: tgagcattccttttgggaac. Inner Left Sequence: tgcttttcccgttcaaactt. Inner Right Sequence: cagaatgcctgtttctccgt. Inner Primer PCR Length: 2208. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1296 |
C. elegans |
C17H12.9(ok1395) IV. Show Description
C17H12.9 Homozygous. Outer Left Sequence: agttcctctgccgcttgtaa. Outer Right Sequence: aagttcggggaatttcgtct. Inner Left Sequence: gcaaccacgtagcttcacaa. Inner Right Sequence: ttggaaatggaatcacccat. Inner Primer PCR Length: 3028. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1297 |
C. elegans |
rhy-1(ok1402) II. Show Description
W07A12.7 Homozygous. Outer Left Sequence: cgtcagcatacccagtgttg. Outer Right Sequence: tcaatggcattagcaactcg. Inner Left Sequence: ctccccgttacattttgcat. Inner Right Sequence: tgggtggcaaaagaaaacat. Inner Primer PCR Length: 2148. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1298 |
C. elegans |
C25E10.11(ok1405) V. Show Description
C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1299 |
C. elegans |
C24H12.9(ok1406) II. Show Description
C24H12.9 Homozygous. Outer Left Sequence: tcaattccttgtttttgggc. Outer Right Sequence: gtcttgctcgcctctttctg. Inner Left Sequence: gtgcctccaaattacgcact. Inner Right Sequence: atcatccgagatccatttgc. Inner Primer PCR Length: 2113. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1300 |
C. elegans |
cdc-14(ok1407) II. Show Description
C17G10.4 Homozygous. Outer Left Sequence: cagtcgtggatgaacactcg. Outer Right Sequence: caccacaaatgactgttccg. Inner Left Sequence: gagacacttttctcggacgg. Inner Right Sequence: tgaatcgaaatcgtgaacca. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1301 |
C. elegans |
unc-23(ok1408) V. Show Description
H14N18.1 Homozygous. Outer Left Sequence: tgaaagcaaacgagacatcg. Outer Right Sequence: accaccacctgatctcttgc. Inner Left Sequence: ttttctgtctcacggagcct. Inner Right Sequence: ccagaaaagggacaaccgta. Inner Primer PCR Length: 2756. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1302 |
C. elegans |
Y2C2A.1(ok1409) IV. Show Description
Y2C2A.1 Homozygous. Outer Left Sequence: tcccatcattctccgaaaag. Outer Right Sequence: gaagaggtggtcgatcagga. Inner Left Sequence: ttgaatgcgtatcggatgaa. Inner Right Sequence: agctcgaggggttttctctc. Inner Primer PCR Length: 3007. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1303 |
C. elegans |
D2096.12(ok1410) IV. Show Description
D2096.12 Homozygous. Outer Left Sequence: aaacgaggagggaaacctgt. Outer Right Sequence: ttcatatgcaaaaccggtca. Inner Left Sequence: gatgagaacgcaacaagcaa. Inner Right Sequence: gggcggcaattaaaaacata. Inner Primer PCR Length: 3247. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1304 |
C. elegans |
wdr-5.1(ok1417) III. Show Description
C14B1.4 Homozygous. Outer Left Sequence: acgctgaagacgaggatgat. Outer Right Sequence: aatatcggcaattacgcagg. Inner Left Sequence: attgtgtgttcgctgtgcat. Inner Right Sequence: cgtatttgctctcggtcgat. Inner Primer PCR Length: 2239. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1305 |
C. elegans |
egl-1(ok1418) V. Show Description
F23B12.9 Homozygous. Outer Left Sequence: caagtcaagacaaggcgaca. Outer Right Sequence: cttccgacactgtaagggga. Inner Left Sequence: ttgtgcctactcctgccttt. Inner Right Sequence: tcacagtcgtttcagcgaac. Inner Primer PCR Length: 2163. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1306 |
C. elegans |
str-182(ok1419) V. Show Description
C12D8.1 Homozygous. Outer Left Sequence: aacatggctttttctggcac. Outer Right Sequence: aaagggaaaattgggcaaag. Inner Left Sequence: acggtgcaaacattggtaca. Inner Right Sequence: ttcgaccttgcttcgaaagt. Inner Primer PCR Length: 2264. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1307 |
C. elegans |
F52D1.1(ok1423) X. Show Description
F52D1.1 Homozygous. Outer Left Sequence: tagcggtatgggcgatttac. Outer Right Sequence: ccggcaagtagattgagagc. Inner Left Sequence: cactgcgaccaaagtcttga. Inner Right Sequence: caatatcacgcaggttgtgg. Inner Primer PCR Length: 2819. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1308 |
C. elegans |
rnp-3(ok1424) IV. Show Description
K08D10.3 Homozygous. Outer Left Sequence: cctttttggcgaatttttca. Outer Right Sequence: gacgctccgatattccgata. Inner Left Sequence: ttcaggttaaaatggccgac. Inner Right Sequence: ggtcttggcacgaatttgat. Inner Primer PCR Length: 2346. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1309 |
C. elegans |
C02C2.1(ok1425) III. Show Description
C02C2.1 Homozygous. Outer Left Sequence: cggcacactggcagttatta. Outer Right Sequence: cgtgcttgttccagatctca. Inner Left Sequence: cagacatggtccaaacatgc. Inner Right Sequence: gggaaggaaaacgacacgta. Inner Primer PCR Length: 2920. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1310 |
C. elegans |
clc-2(ok1426) X. Show Description
C01C10.1 Homozygous. Outer Left Sequence: ctccggttgcatcagaaaat. Outer Right Sequence: cctgccaagctggtgttatt. Inner Left Sequence: tgttcaaatttttgctgcca. Inner Right Sequence: tttgtttgtcagcagtccgt. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1311 |
C. elegans |
R05D11.8(ok1427) I. Show Description
R05D11.8 Homozygous. Outer Left Sequence: gctgcgtgaacatcaagaaa. Outer Right Sequence: attccaacgacttgccaaag. Inner Left Sequence: tttgaccatggcgaatgtta. Inner Right Sequence: tagagggatcgctggagaaa. Inner Primer PCR Length: 2546. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1312 |
C. elegans |
C54E4.2(ok1428) IV. Show Description
C54E4.2 Homozygous. Outer Left Sequence: aaaatgcccacttgcgatac. Outer Right Sequence: gggggaaaactgtttccatt. Inner Left Sequence: aatgcgaatttctttggacg. Inner Right Sequence: aatgcaacaaaccaccaaca. Inner Primer PCR Length: 2878. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1313 |
C. elegans |
C05C10.2(ok1429) II. Show Description
C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1314 |
C. elegans |
C05C10.2(ok1430) II. Show Description
C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1315 |
C. elegans |
C49G7.1(ok1431) V. Show Description
C49G7.1 Homozygous. Outer Left Sequence: cttatgggtttcaccacgct. Outer Right Sequence: cggctggaaaaagttaccaa. Inner Left Sequence: gcaaactcgaaagcagttcc. Inner Right Sequence: agtagcgggcaaaagactga. Inner Primer PCR Length: 2650. Deletion Size: 1045 bp. Deletion left flank: AAAAATGCAACGACCGACTTCAACGGCCACC. Deletion right flank: TTTGTACTGAACTTTCTTAACCAGGTACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1316 |
C. elegans |
unc-105(ok1432) II. Show Description
C41C4.5 Homozygous. Outer Left Sequence: gttatgacgaagagcgaggc. Outer Right Sequence: cgaagaccataattcgctcc. Inner Left Sequence: cgtttgagcacaccttcaaa. Inner Right Sequence: catctctccaactgcgaaca. Inner Primer PCR Length: 3052. Estimated Deletion Size: about 950 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1317 |
C. elegans |
srp-3(ok1433) V. Show Description
Y32G9 Homozygous. Outer Left Sequence: ttcacctctttcaattgccc. Outer Right Sequence: gaaaatcgaaattcggcaaa. Inner Left Sequence: ctaagtggtgccactgacga. Inner Right Sequence: tatatcgacccgagccaaac. Inner Primer PCR Length: 2659. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1318 |
C. elegans |
Y66D12A.5(ok1436) III. Show Description
Y66D12A.5 Homozygous. Outer Left Sequence: caagcttctcacaccgatca. Outer Right Sequence: gctacgcttcaagaaatccg. Inner Left Sequence: attgctcgaaaagctggaaa. Inner Right Sequence: cggacctcttcatcgtcatt. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1319 |
C. elegans |
C34D4.14(ok1437) IV. Show Description
C34D4.14 Homozygous. Outer Left Sequence: ttttgcctcccttcttctga. Outer Right Sequence: atttcttcatcggcaccaac. Inner Left Sequence: attggtggtagcgtctttgg. Inner Right Sequence: ggatggagttcacacggagt. Inner Primer PCR Length: 3257. Estimated Deletion Size: about 1150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1320 |
C. elegans |
Y67D8A.3(ok1438) IV. Show Description
Y67D8A.3 Homozygous. Outer Left Sequence: aatttgtgcaaacaccgtca. Outer Right Sequence: gacaacctttgcgctttttc. Inner Left Sequence: ttttgtcaacaaattcggca. Inner Right Sequence: gccactctacttttcgccac. Inner Primer PCR Length: 2198. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1321 |
C. elegans |
C56G3.1(ok1439) X. Show Description
C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1322 |
C. elegans |
F33H2.6(ok1440) I. Show Description
F33H2.6 Homozygous. Outer Left Sequence: acggtgctagattcggaaaa. Outer Right Sequence: tgttcgaaaaaggttttggc. Inner Left Sequence: agatccggaatttcaccaga. Inner Right Sequence: cgggatttttcaccatctgt. Inner Primer PCR Length: 2165. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1323 |
C. elegans |
C06G1.5(ok1441) X. Show Description
C06G1.5 Homozygous. Outer Left Sequence: gcatagcaccgtgaatgaga. Outer Right Sequence: gcgtaggatggattgaagga. Inner Left Sequence: ttcgtgaacatttggggaat. Inner Right Sequence: ctggcagtgcgaatcaacta. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1324 |
C. elegans |
ssr-2(ok1375) X. Show Description
C14A11.7 Homozygous. Outer Left Sequence: ttctttcacccccttttcct. Outer Right Sequence: cgccttatttcagcttttgc. Inner Left Sequence: ttttgcaatcactctcgtcg. Inner Right Sequence: gcaaggaaggcattttggta. Inner Primer PCR Length: 2887. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1325 |
C. elegans |
C53C7.1(ok1442) X. Show Description
C53C7.1 Homozygous. Outer Left Sequence: ggatcgtcttgtggtgcttt. Outer Right Sequence: ggggcctcttaacctttttg. Inner Left Sequence: ctggattgccctgaaattgt. Inner Right Sequence: gcagacaaagcatgacctga. Inner Primer PCR Length: 3020. 11/18/04: From Neline Kriek: This has a 788 bp deletion with a 13 bp insertion (TTCTTTTTTTTGA). The sequence across the breakpoint is: actacgacgtggtgtctttTTCTTTTTTTTGAtgacgtgagtttt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1326 |
C. elegans |
unc-129(ok1443) IV. Show Description
C53D6.2 Homozygous. Outer Left Sequence: agtcgtttctaccgcttcca. Outer Right Sequence: acctttgccggttcctctat. Inner Left Sequence: aacaaaacatcgggacgaag. Inner Right Sequence: tggtcaccgatatgggaact. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1327 |
C. elegans |
K04G11.4(ok1444) X. Show Description
K04G11.4 Homozygous. Outer Left Sequence: aaccctccacttttgtcacg. Outer Right Sequence: gttaagggcagcaaccaaaa. Inner Left Sequence: tctggcagtgtgcaaatgat. Inner Right Sequence: ggggccttgagaccttatgt. Inner Primer PCR Length: 2137. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1328 |
C. elegans |
dsh-1(ok1445) II. Show Description
C34F11.9. Homozygous. Outer Left Sequence: ATTCTTCCATCCAATGCCAC. Outer Right Sequence: AGTGCATCATGAGCCACAAG. Inner Left Sequence: TGCTCTAGAGGGTTTTCGGA. Inner Right Sequence: GAGAACGACACGATTGCTCA. Inner Primer PCR Length: 3156 bp. Deletion Size: 1132 bp. Deletion left flank: CGGATTCGGAGCCAATTGTTGATTCTTCGA. Deletion right flank: AATGGTGCCTCAGACTCCGGCTCCACACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1329 |
C. elegans |
C56G3.1(ok1446) X. Show Description
C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 779 bp. Sequence across the breakpoint: GGTATGTAGAACTTTTTTTTTGAA-breakpoint-AACAAAATGAGCAAAACTCGTGC . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1330 |
C. elegans |
npr-1(ok1447) X. Show Description
C39E6.6 Homozygous. Outer Left Sequence: tcagcaaaattcccgatttc. Outer Right Sequence: gaacctgttagtgggccaag. Inner Left Sequence: gatcaattcttccggctcag. Inner Right Sequence: ggccaaatggaagttgaaaa. Inner Primer PCR Length: 2687. 11/24/04: From Neline Kriek: ok1447 is a 1263 bp deletion with a 1 bp insertion (T). The sequence is: gtatcagcattttcgtatgcacTacgttttgagaagtttcatt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1331 |
C. elegans |
end-3(ok1448) V. Show Description
F58E10.5 Homozygous. Outer Left Sequence: cgggaatagcggtaatttga. Outer Right Sequence: gtgatgtgcgtggctgtaac. Inner Left Sequence: cactctcgcacgtgaaaaac. Inner Right Sequence: caatgcctgtcttttgagca. Inner Primer PCR Length: 2119. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|