Search Strains

More Fields
Strain Species Genotype Add
RB1075 C. elegans pes-9(ok1037) V. Show Description
R11H6.1 Homozygous. Outer Left Sequence: CTTCGATGAGACAGCCACAA. Outer Right Sequence: TTACTGGAAGTTTCCCCGTG. Inner Left Sequence: CAACGGCAACAAGATTAGGG. Inner Right Sequence: GTGAAGCAGTGGCAATTCAA. Inner Primer PCR Length: 2301. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1077 C. elegans rgs-10(ok1039) X. Show Description
F45B8.2 Homozygous. Outer Left Sequence: AAACCACAGGGTCTGACAGG. Outer Right Sequence: CTTGCGCGACATCAAAAGTA. Inner Left Sequence: GGCATGTTCACTCGGAATTT. Inner Right Sequence: CGTTTGTGCAGAGTGAAGGA. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1078 C. elegans T10G3.5(ok1040) V. Show Description
T10G3.5 Homozygous. Outer Left Sequence: GCTTCCAATTCTCTTGCTCG. Outer Right Sequence: ATTTAAGCGGAACAGCCTCA. Inner Left Sequence: TGAACTGCGTCTTCAATTCG. Inner Right Sequence: GAAATCAGAGGGAATCCGGT. Inner Primer PCR Length: 2757. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1079 C. elegans alg-4(ok1041) III. Show Description
ZK757.3 Homozygous. Outer Left Sequence: GGATTTGGTCCGAAGTAGCA. Outer Right Sequence: GCCGATGATCAAGGATCTGT. Inner Left Sequence: GAGTTGGAATGGAGACCGAA. Inner Right Sequence: CAATATGCGTGAGGTGGTTG. Inner Primer PCR Length: 2888. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1080 C. elegans haf-4(ok1042) I. Show Description
W04C9.1. Homozygous. Outer Left Sequence: AGTCCTTGGGTCTCACAACG. Outer Right Sequence: ACGATTTGTTCCTGCCAATC. Inner Left Sequence: CCGTGAAAAAGTACGCGTTT. Inner Right Sequence: GCACTCTAAACACTTCCGGC. Inner Primer PCR Length: 2570 bp. Deletion Size: 1678 bp. Deletion left flank: ACACGGGACAAGTCATCGCTACCGTGGTCG. Deletion right flank: GCGTCAATTTCGGTTCGACAAATCGTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1081 C. elegans klf-2(ok1043) V. Show Description
F53F8.1 Homozygous. Outer Left Sequence: GTTACTGTTTGCCCATGCCT. Outer Right Sequence: CGTCTTGTTCATCCGTTTCA. Inner Left Sequence: GAAATGCCCAAAAGTGTCGT. Inner Right Sequence: CTCGAAAATTTCCTGGAGCA. Inner Primer PCR Length: 3195. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1082 C. elegans K12G11.2(ok1048) V. Show Description
K12G11.2 Homozygous. Outer Left Sequence: TGTCAGGTGGAATACGACGA. Outer Right Sequence: ACATATTCCGAAAAGTGCCG. Inner Left Sequence: TGTTCCATTCACTTCCGTCA. Inner Right Sequence: TGCACGTACACATTCTGCAA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1083 C. elegans F27C8.5(ok1050) IV. Show Description
F27C8.5 Homozygous. Outer Left Sequence: AGATTGCGTCTGTGTGATCG. Outer Right Sequence: CTAGAGAAAGGTGCATCGGC. Inner Left Sequence: CGCGGCTTCACAAATAAAAT. Inner Right Sequence: AGAACCTCTTTTCCGGTGGT. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1084 C. elegans oct-1(ok1051) I. Show Description
F52F12.1 Homozygous. Outer Left Sequence: TATCGGAGTGTCGATGCAAG. Outer Right Sequence: CAGCCTACCTTCGTGCCTAC. Inner Left Sequence: GATTCTCGTTTCTTGGCTGC. Inner Right Sequence: GCAAGAGGCAGGCATAGTTC. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1085 C. elegans tir-1(ok1052) III. Show Description
F13B10.1a Homozygous. Outer Left Sequence: GCAATCAAAGTTTCCAGCGT. Outer Right Sequence: CCTTGTCCTACTCAGCCAGC. Inner Left Sequence: AGATAAAGTCGGCAACCTGC. Inner Right Sequence: CAAATGGCGATCTGTACCCT. Inner Primer PCR Length: 3224. Estimated Deletion Size: about 1900 bp. From Nathalie Pujol 11/04: breakpoints, with a 8 bases insertion, AAATGTCGCCGGATCGTGAACTTGCAAGAAT/AGAATAAA/TGTAGACAGTGCTGGCGT AATTCGCCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1086 C. elegans inx-5(ok1053) X. Show Description
R09F10.4 Homozygous. Outer Left Sequence: TTGCAAGCATTATTTGCGAG. Outer Right Sequence: ATTCCATTTTCCCATCCTCC. Inner Left Sequence: GGCAGCTTGACACAATTGAA. Inner Right Sequence: TTATTGCCGGTGGTTCTGAT. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1087 C. elegans kal-1(ok1056) I. Show Description
K03D10.1 Homozygous. Outer Left Sequence: TTTTCCGGAAGATTCCAGTG. Outer Right Sequence: AAAAATGCGGGAATGTTTTG. Inner Left Sequence: GCTGAAAAATCGTGGGAAAA. Inner Right Sequence: CCCATTTTCTTTTGCAGGAA. Inner Primer PCR Length: 2786. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1088 C. elegans magu-2(ok1059) V. Show Description
C01B7.4 Homozygous. Outer Left Sequence: AAAGACCGGGGAGAGATGAT. Outer Right Sequence: GCATATTCTTTTTGGCGCTC. Inner Left Sequence: TAGCACGCTGTCCATGTAGC. Inner Right Sequence: TTGACTCATACGCCCAATCA. Inner Primer PCR Length: 3137. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1089 C. elegans hpl-1(ok1060) X. Show Description
K08H2.6 Homozygous. Outer Left Sequence: CCGACATAGGTTTGCACCTT. Outer Right Sequence: CGAAGTGGAATTGGTGGTCT. Inner Left Sequence: CAAGATGCTCCGTTGTTTCA. Inner Right Sequence: GGAGTCGGGAATCAGTCAGA. Inner Primer PCR Length: 2728. Upper breakpoint flanking sequence: TTCGGATTTGAAAGAGTCTGAAAAAGAT. Lower breakpoint flanking sequence: TTGAACTGTAGTCTTTGCTACTTCTT. Deletion Size: 1948 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1090 C. elegans hpl-2(ok1061) III. Show Description
K01G5.2 Homozygous. Outer Left Sequence: TTTTTACGGGCGAAATTCAG. Outer Right Sequence: AATTCAGTGATGACACGGCA. Inner Left Sequence: AATTTGTCGATGCACCATGA. Inner Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Primer PCR Length: 2358. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1091 C. elegans Y64G10A.7(ok1062) IV. Show Description
Y64G10A.7 Homozygous. Outer Left Sequence: AAAGACCGGACCACTTTGTG. Outer Right Sequence: AACTCACGTTGGACCGAATC. Inner Left Sequence: GTGCGCACACTTGTTCTTGT. Inner Right Sequence: CGATTGACATGCAATTTTCG. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1092 C. elegans E02H1.2(ok1070) II. Show Description
E02H1.2 Homozygous. Outer Left Sequence: TTTTCCAAGGTGGACCAAAG. Outer Right Sequence: CTTTTCTCGACGGCTTCAAC. Inner Left Sequence: TTGCTAGGGAGCATCCAAGT. Inner Right Sequence: CCCAATACAACCAGCAACAA. Inner Primer PCR Length: 2359. Estimated Deletion Size: about 350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1093 C. elegans C08H9.2(ok1071) II. Show Description
C08H9.2 Homozygous. Outer Left Sequence: CATCTTTTCCTGCAACGACA. Outer Right Sequence: AACATCACTTTCCGTTTGGC. Inner Left Sequence: GGATCTTCTGCTCCTTGACG. Inner Right Sequence: GGACGTCTCATTGGAAAGGA. Inner Primer PCR Length: 3020. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1094 C. elegans tag-52(ok1072) X. Show Description
C02F12.4 Homozygous. Outer Left Sequence: GCAAATACCACCACCACACA. Outer Right Sequence: TATAAACGACGGGAAAACGC. Inner Left Sequence: AAGCTCACCGCAAACTCAAT. Inner Right Sequence: ACATACAGCACGGCATTTGA. Inner Primer PCR Length: 2998. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1095 C. elegans chup-1(ok1073) X. Show Description
ZK721.1 Homozygous. Outer Left Sequence: AATTTCAGGCGCTATGAGGA. Outer Right Sequence: CTTGAAATAAAAGCGCGAGG. Inner Left Sequence: TGGGATGTGGTGTACGAAAA. Inner Right Sequence: CAGGAAATGACAGCAGCAAA. Inner Primer PCR Length: 2993. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1096 C. elegans R06C7.1(ok1074) I. Show Description
R06C7.1 Homozygous. Outer Left Sequence: GCTCCACCAGGAGCTATGAC. Outer Right Sequence: AAATCGAACAAAATTCCCCC. Inner Left Sequence: TGTACATGAAGCCAACCGAA. Inner Right Sequence: CGGTTTGTTTGTAGCCGATT. Inner Primer PCR Length: 2933. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1097 C. elegans grl-4(ok1076) IV. Show Description
F42C5.7 Homozygous. Outer Left Sequence: AAGCCACGTAACAAAATCCG. Outer Right Sequence: AGTGATCAGAGATGGGCTGG. Inner Left Sequence: TACTGTCCAGGGGAGATTCG. Inner Right Sequence: GGCAATGTCGAGAAGGAAAC. Inner Primer PCR Length: 2926. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1098 C. elegans hsp-12.6(ok1077) IV. Show Description
F38E11.2 Homozygous. Outer Left Sequence: GTGACGATTCGAGAGCAACA. Outer Right Sequence: CGTGCGAAGATTGAACAGAA. Inner Left Sequence: TTCGAAGCTCAATGAACGAA. Inner Right Sequence: AGCCCAAGATGACAATGGAC. Inner Primer PCR Length: 2303. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1099 C. elegans F55A12.1(ok1078) I. Show Description
F55A12.1 Homozygous. Outer Left Sequence: GAAAGCCAATAACTCGAGCG. Outer Right Sequence: ACGAACATCAGGAAGAACCG. Inner Left Sequence: GGCAGACTTGCATCCATTTT. Inner Right Sequence: AATTGTTGTTGCCTCGATCC. Inner Primer PCR Length: 2978. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1100 C. elegans ver-4(ok1079) X. Show Description
F59F3.5 Homozygous. Outer Left Sequence: CCAAAAATGCACATGTACCG. Outer Right Sequence: TGATGAAGAAGCTCCAGCAA. Inner Left Sequence: TCTCCGAGGGGCAATACTAA. Inner Right Sequence: TTCGTTGCAGAACACCAAAA. Inner Primer PCR Length: 2587. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1101 C. elegans scpl-1(ok1080) I. Show Description
B0379.4 Homozygous. Outer Left Sequence: GAAGAACCGGGAGTCAACTG. Outer Right Sequence: AATTTTGAGGGCAGCTACGA. Inner Left Sequence: TTGAAAATTGGAACGAAGGC. Inner Right Sequence: AAGTATGCGGGAACCACAAC. Inner Primer PCR Length: 2908. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1102 C. elegans ZK370.3(ok1081) III. Show Description
ZK370.3. Homozygous. Outer Left Sequence: GTGCACAAATTGCTTCGAGA. Outer Right Sequence: CCAACACTCTAGCAGCCACA. Inner Left Sequence: TGGTCCATGCATTGAGTCAT. Inner Right Sequence: TAGAATTCTGCAGGCGATCC. Inner Primer PCR Length: 3308 bp. Deletion Size: 1444 bp. Deletion left flank: GCAGAGCCACAACAAGCGAGTCCATCGAGT. Deletion right flank: AAGAAATTTTGGATAAATGTATTTTTTTTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1103 C. elegans ceh-18(ok1082) X. Show Description
ZC64.3 Homozygous. Outer Left Sequence: TCGGTCATTTTGGCATGATA. Outer Right Sequence: GCTGACCCCTATTCCCTCAT. Inner Left Sequence: CGATGTTGCGTTCATAGTGG. Inner Right Sequence: CGCCCAAAATTTTTCATCAT. Inner Primer PCR Length: 3110. Estimated Deletion Size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1104 C. elegans hsp-3(ok1083) X. Show Description
C15H9.6 Homozygous. Outer Left Sequence: GGGGTAGGAGAGCCATTTTC. Outer Right Sequence: ACTTGGCCTTTTCCGATTTT. Inner Left Sequence: CGATCGTTTAGAGCTCGTCC. Inner Right Sequence: CCTGCCGTTTCCATAACAGT. Inner Primer PCR Length: 2947. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1105 C. elegans brp-1(ok1084) III. Show Description
Y79H2A.1 Homozygous. Outer Left Sequence: TTGTGCGCATTGATCTCTTC. Outer Right Sequence: GTATCAGAAACCTCAGCGGC. Inner Left Sequence: CAGCTGATTTCGCATGGTTA. Inner Right Sequence: GAATGCAGTGTTGATGGGTG. Inner Primer PCR Length: 3016. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1106 C. elegans ape-1(ok1085) V. Show Description
F46F3.4 Homozygous. Outer Left Sequence: CAAACAATTGAAATGTGCGG. Outer Right Sequence: GGATTTCGAAAAATGGGGAT. Inner Left Sequence: CAAAAGCTCCAATTCGCTTC. Inner Right Sequence: AGCGTCTTCGTCTGATTGGT. Inner Primer PCR Length: 2748. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1107 C. elegans haf-3(ok1086) V. Show Description
F57A10.3. Homozygous. Outer Left Sequence: TTTCGGAAATTTTATTGCGG. Outer Right Sequence: CCGTGCATTGATCACTTGTT. Inner Left Sequence: TTTGCATTCCTTCCAAATCC. Inner Right Sequence: TTGAAAACCCTCCTCGTGTC. Inner Primer PCR Length: 2930 bp. Deletion Size: 1150 bp. Deletion left flank: GTGTTTCAGGGAAAAAAATCTACAAAATTT. Deletion right flank: TATTTTTGAAGAAATTTTCTTAATTTTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1108 C. elegans pmp-3(ok1087) V. Show Description
C54G10.3 Homozygous. Outer Left Sequence: AAACGATCGAAAAGCAGGAA. Outer Right Sequence: CACCAAAATGCCAGTGTGAC. Inner Left Sequence: ATTTTTGAAATCGTGCCGAG. Inner Right Sequence: GTCGTTCTGAACTAAGGCGG. Inner Primer PCR Length: 3268. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1109 C. elegans cit-1.1(ok1088) III. Show Description
F44B9.4 Homozygous. Outer Left Sequence: TTTGGAGCTTTGGAGCAGTT. Outer Right Sequence: CTTCACCAAAGAGGAGGTGC. Inner Left Sequence: ATTCTCCACCAGCTCATTCG. Inner Right Sequence: AGCGAGCATTCAAGAAGGAA. Inner Primer PCR Length: 3011. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1110 C. elegans C17E4.9(ok1089) I. Show Description
C17E4.9 Homozygous. Outer Left Sequence: AAAATTTGCCCTCCTTCCAT. Outer Right Sequence: CTCATCCACACCGAAAACCT. Inner Left Sequence: CAAACTTCCCCCTCTTCCTC. Inner Right Sequence: ATGAGAAGAGACCTGCCTCG. Inner Primer PCR Length: 2190. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1111 C. elegans srp-7(ok1090) V. Show Description
F20D6.4 Homozygous. Outer Left Sequence: ATTCGTTCTTTTGACACCGC. Outer Right Sequence: TTTCATCTTTTTCCGGCATC. Inner Left Sequence: CAACATAACCTTTCGTCGCA. Inner Right Sequence: CCGCAACAGCTACAGTACCA. Inner Primer PCR Length: 2226. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1112 C. elegans C45B2.6(ok1098) X. Show Description
C45B2.6 Homozygous. Outer Left Sequence: ACACAGTCCGACAAAACGTG. Outer Right Sequence: GTTTTCCCCGAAAAGGTTGT. Inner Left Sequence: TACGCGGATGCTCAACATAA. Inner Right Sequence: GAAAGGCACCGGTGATTAAA. Inner Primer PCR Length: 3227. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1113 C. elegans H25P06.4(ok1099) I. Show Description
H25P06.4 Homozygous. Outer Left Sequence: gcgatccaatattagccgaa. Outer Right Sequence: aggttatgctttgtggtcgg. Inner Left Sequence: aatctctcagggctcaacga. Inner Right Sequence: gattatgagcgtggccattt. Inner Primer PCR Length: 2971. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1114 C. elegans F35C5.12(ok1103) II. Show Description
F35C5.12 Homozygous. Outer Left Sequence: aagctccacgtgcattctct. Outer Right Sequence: gacagccacgtgctttgata. Inner Left Sequence: aaagtcgatggacaagtcgg. Inner Right Sequence: tgaaagcctaccagagcgtt. Inner Primer PCR Length: 2307. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1115 C. elegans mec-10(ok1104) X. Show Description
F16F9.5 Homozygous. Outer Left Sequence: tcatttgcagcattttctcg. Outer Right Sequence: atttatcaatcaggcggtcg. Inner Left Sequence: gtccaaggtgtcctccaaaa. Inner Right Sequence: tgaagtttgacacaggcgag. Inner Primer PCR Length: 3339. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1116 C. elegans egl-4(ok1105) IV. Show Description
F55A8.2b Homozygous. Outer Left Sequence: AAAGTTGGTTGTGGACGGAG. Outer Right Sequence: ACTGCACAAAAATTCGAGGC. Inner Left Sequence: AGAACCGCATCAGTTCAAGC. Inner Right Sequence: TTTTGGACGAATTTTGGAGG. Inner Primer PCR Length: 2432. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1117 C. elegans Y47G6A.14(ok1106) I. Show Description
Y47G6A.14 Homozygous. Outer Left Sequence: aggtgtcaagaagagccgaa. Outer Right Sequence: cctccttgagacttgaagcg. Inner Left Sequence: cttgagcgaggtgtaggctt. Inner Right Sequence: gccaggaagaatttggtgaa. Inner Primer PCR Length: 3237. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1118 C. elegans ZK370.4(ok1107) III. Show Description
ZK370.4 Homozygous. Outer Left Sequence: ATCAGATCTTCGATCCGGTG. Outer Right Sequence: GTTTGATCCGTCGTGGAAGT. Inner Left Sequence: ATCACTTCAGCTCGGCTCAT. Inner Right Sequence: CGAGTGGAAGCTTGATCCTC. Inner Primer PCR Length: 3173. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1119 C. elegans ubr-5(ok1108) I. Show Description
F36A2.13 Homozygous. Outer Left Sequence: ctgcctgataccacccactt. Outer Right Sequence: tcttgcaatggttccacatc. Inner Left Sequence: tggaagctcacaagctcaga. Inner Right Sequence: ggaagctcttggagcagatg. Inner Primer PCR Length: 3184. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1120 C. elegans amt-3(ok1113) II. Show Description
M195.3 Homozygous. Outer Left Sequence: tctggcggctcttcttttta. Outer Right Sequence: tgcactcgggtaacattcag. Inner Left Sequence: cagccaaaccatgttcaatg. Inner Right Sequence: attatggcacaagggagacg. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1121 C. elegans vkmt-1(ok1114) IV. Show Description
C42C1.13; might also remove part of C42C1.11. Homozygous. Outer Left Sequence: aaacacgaaacactcgcctt. Outer Right Sequence: ccgatcctttttcgtatgga. Inner Left Sequence: ccttaaaagagtctcggccc. Inner Right Sequence: atgaaaaagcgtcatctggg. Inner Primer PCR Length: 2226. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1122 C. elegans T12B5.3(ok1129) III. Show Description
T12B5.3 Homozygous. Outer Left Sequence: acattccacactttcctggc. Outer Right Sequence: gttgcgatgaagagcacaaa. Inner Left Sequence: ctccactcgcatttttccat. Inner Right Sequence: ggatgcagattgctccaaat. Inner Primer PCR Length: 2203. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1123 C. elegans Y105E8A.10(ok1130) I. Show Description
Y105E8A.10 Homozygous. Outer Left Sequence: gcgtgacgacggtcttttat. Outer Right Sequence: tttcgagttcaaaattcggg. Inner Left Sequence: tagtcgttgttgttggcagc. Inner Right Sequence: acaacacatttaacgcgcaa. Inner Primer PCR Length: 2600. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1124 C. elegans exp-1(ok1131) II. Show Description
H35N03.1 Homozygous. Outer Left Sequence: AGATCCAATGAAATCGGTGC. Outer Right Sequence: ACATCGTTTTTATGGCCACC. Inner Left Sequence: TTGCCTTGCAAGACTCAAAA. Inner Right Sequence: CACAGCATCGACCAGAAATG. Inner Primer PCR Length: 2329. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1125 C. elegans vang-1(ok1142) X. Show Description
B0410.2a Homozygous. Outer Left Sequence: gtcataaacgccgagtcgat. Outer Right Sequence: caaatcaaactgccgactca. Inner Left Sequence: ctggaatgacgacggattct. Inner Right Sequence: ttttcatttccaggtttggc. Inner Primer PCR Length: 3370. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807