Search Strains

xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx384 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD) + rol-6(su1006)]. Rollers. Rollers express HMR-1 intracellular domain pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx385 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD-M) + rol-6(su1006)]. Rollers. Rollers express mutated HMR-1 intracellular domain (unable to bind catenins) pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

xnIs528 [hmp-1p::hmp-1::GFP + unc-119(+)]. HMP-1::GFP localized to cell contacts in early embryo and junctions in later stages. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

xnIs3[par-6:PAR-6::GFP + unc-119(+)]. Wild type worms. Express PAR-6::GFP in early embryos and epithelial cells.

xnIs78 [cdc-42p::2xHA::cdc-42 + unc-119(+)]. Superficially wild-type. Reference: Anderson DC, et al. (2008) Science 320(5884):1771-4.

xnIs87 [syn-4p::GFP::syn-4::syn-4 3'UTR + unc-119(+)].

xnIs96 [pJN455(hmr-1p::hmr-1::GFP::unc-54 3'UTR) + unc-119(+)]. GFP starts in membranes at~100 cell stage, becomes bright apically in older embryos and larvae; most prominent in nerve ring in adults. Reference: Achilleos et al. (2010) Development 137(11):1833-42.

xnIs162 [ect-2::GFP + unc-119(+)]. Transgene rescues sterility of ect-2(gk44). Reference: Chan E & Nance J. J Cell Sci. 2013 Apr 1;126(Pt 7):1692-702.

xnIs178 [mCherry::pac-1 + unc-119(+)]. Translational fusion to PAC-1. mCherry::PAC-1 is expressed in pharyngeal muscle cells (mostly apical, some basal), a few cells in the vulva, maternally in early embryos at cell contacts, and at adherens junctions in late embryogenesis. Maternal expression is difficult to detect by eye but visible with longer camera exposure. Reference: Anderson DC, et al. Science 2008: 320: 1771-1774.

xnIs243 [picc-1p::picc-1::GFP + unc-119(+)]. Weak maternal expression visible at early embryo cell contacts. Stronger zygotic expression visible at junctions of epithelial cells. Transgene generated from a recombineered genomic fosmid clone. Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744.

xnSi6 [mex-5p::hmr-1::GFP::hmr-1 3'UTR + unc-119(+)] II. HMR-1::GFP localized at cell contacts in early embryos and becomes enriched in PGCs. Reference: Chihara D & Nance J. Development. 2012 Jul;139(14):2547-56. Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

xnIs299 [hmr-1p::hmr-1::mCherry + unc-119(+)]. Translational fusion to hmr-1. HMR-1::mCherry is visible in multiple tissues including pharynx, intestine, epidermis and gonad; also marks the adherens junctions in epithelia. No visible maternal expression. Reference: Zilberman Y, et al. 2017: J Cell Biol. (In press).

xnIs312 [par-6p::par-6::mCherry + unc-119(+)]. Expresses par-6::mCherry maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.

xnIs27 [pie-1p::GFP::pac-1 + unc-119(+)]. Maintain at 25C to slow silencing of transgene. xnIs27 rescues pac-1(xn6). GFP::PAC-1 localized at contacts in early embryos. Reference: Anderson DC, et al. Science. 2008 Jun 27;320(5884):1771-4. Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

pkIs1642 [sir-2.1(+) + unc-119(+)]. Derived by outcrossing NL3908 to HT1593 (six times). Reference: Burnett C, et al. Nature. 2011 Sep 21;477(7365):482-5.

pkIs1641 [unc-119(+)]. Derived by outcrossing NL3908 to HT1593 (six times). Reference: Burnett C, et al. Nature. 2011 Sep 21;477(7365):482-5.

naIs3 [(pGC133) hsp-16.41::FLP:::let-858 3'UTR) + Cbr-unc-119(+)].

naIs6 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+) + ceh-22p::GFP)].

naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.

naIs7 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+)]. Does not express ceh-22p::GFP, but unc-119 is rescued.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.

mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.

mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.

mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.

mgTi1 [rpl-28p::skn-1a::GFP::tbb-2 3'UTR + unc-119(+)] I. Expresses SKN-1A with C-terminal GFP tag. Reference: Lehrbach NL & Ruvkun G. Elife. 2016 Aug 16;5. pii: e17721

arSi159 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 (II). The first intron of GFP was replaced with a Flexon containing two loxP sites. High level GFP::H2B expression requires Cre expression from a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.

aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR] II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST] II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi26 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi31 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi27 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7s::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7s in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi36 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7f::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Express GFP::H2B in germline and early embryos. Might still carry unc-119(ed3) in background. Reference: Zeller P, et al. Nat Genet. 2016 Nov;48(11):1385-1395. doi: 10.1038/ng.3672. PMID: 27668659.

bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP_D5 + unc-119(+)] IV. ygIs2 [baf-1::GFP::lmn-1(Y59C) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1 (Y59C mutation). Might still carry unc-119(ed3) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.

gwIs28 [myo-3::mCherry + 256xlacO + unc-119(+)]. Superficially wild-type. Contains a small lacO array co-integrated with a muscle specific mCherry reporter (~10x smaller than the gwIs4 array). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs34 [myo-3::mCherry + 256xlacO + unc-119(+)] III. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Slow growing and dumpy. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676

isIs17 [pGZ295 (pie-1p::GFP::pcn-1(W03D2.4)) + pDP#MM051 (unc-119(+))] Maintain at 25C if possible to avoid possible germ line silencing. The entire coding sequence of PCNA (PCN-1, W03D2.4) was PCR-amplified and the resulting fragment cloned into pie-1::GFP germline expression vector to generate pGZ295, which was co-bombarded with pDP#MM051, which carries an unc-119 cDNA. The transgenic line behaves as though the two plasmids have been jointly integrated.

emcSi70 [unc-119p::TIR1::mRuby] (IV: -0.05). TIR1 expression driven by the unc-119 promoter, allowing degradation of AID-tagged proteins specifically in neurons. Reference: Sabatella M, et al. Cell Rep. 2021 Jan 12;34(2):108608. PMID: 33440146

emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). TIR1 expression driven by the myo-3 promoter, allowing degradation of AID-tagged proteins specifically in muscles. Reference: Sabatella M, et al. Cell Rep. 2021 Jan 12;34(2):108608. PMID: 33440146

goeIs257 [nas- 38p::d1mGFP::nas-38 3'UTR + unc-119(+)]. Destabilized GFP expressed from the nas-38 promoter; especially visible in hypodermis and excretory system. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeEx711 [nlp-42p::mGFP::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Construct contains 2000 bp of nlp-42 promoter upstream of start. Expression pattern is variable between worms.