Search Strains

ckSi4 [cdk-9::mCherry + unc-119(+)] II. Reference: Bowman EA, et al. Development. (In Press).

ckSi10 [ccnk-1::FLAG + unc-119(+)] II. Reference: Bowman EA, et al. Development. (In Press).

ckSi6 [cdk-12::GFP + unc-119(+)] I. ckSi6 rescues cdk-12(tm3846). GFP expressed in all nuclei. Reference: Bowman EA, et al. Development. (In Press).

ckSi14 [cit-1.2::GFP + unc-119(+)] II. Reference: Bowman EA, et al. Development. (In Press).

ckSi15 [ccnk-1::GFP + unc-119(+)] II. Reference: Bowman EA, et al. Development. (In Press).

ckSi9 [cdk-12(D462N)::GFP + unc-119(+)] I. Reference: Bowman EA, et al. Development. (In Press).

ckSi12 [cdk-9(D235N)::mCherry + unc-119(+)] II. Reference: Bowman EA, et al. Development. (In Press).

ckSi13 [cdk-9::GFP + unc-119(+)] II. Reference: Bowman EA, et al. Development. (In Press).

ckSi12 [cdk-9(D235N)::mCherry + unc-119(+)] II. Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi4 [cdk-9::mCherry + unc-119(+)] II. ckSi4 rescues cdk-9(tm2884). mCherry is expressed in all nuclei. Reference: Bowman EA, et al. Development. (In Press).

ckSi6 [cdk-12::GFP + unc-119(+)] I. ckSi6 rescues cdk-12(tm3846). ckSi4 [cdk-9::mCherry + unc-119(+)] II. ckSi4 rescues cdk-9(tm2884). GFP and mCherry is expressed in all nuclei. Reference: Bowman EA, et al. Development. (In Press).

ckSi17 [cdk-12::GFP::mex-5 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi20 [cdk-9::mCherry::mex-5 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi21 [cdk-9::GFP::pal-1 3'UTR + unc-119(+)] II. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi21 [cdk-9::mCherry::pal-1 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi21 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).

ckSi6 [cdk-12::GFP + unc-119(+)] I. ckSi6 rescues cdk-12(ok3664). GFP expressed in all nuclei. Reference: Bowman EA, et al. Development. (In Press).

ckSi25 [cit-1.2::FLAG::ccnk-1 3'UTR + unc-119(+)] II. GFP is expressed in all somatic nuclei. Reference: Bowman EA, et al. Development. (In Press).

rnyEx60 [vha-6p:::vha-6::mCherry + myo-3p::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. Labels apical intestinal membrane. Reference: Allman et al. (2009) Am J Physiol Cell 297:C1071-81.

uaEx25 [(p016bA352V) nuo-1(+) + unc-119(+)]. Contains extrachromosomal nuo-1(A352V) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of the transgene. Low brood size. Short life span. Sensitive to oxidative stress.

uaIs26 [(p016bT434M) nuo-1(+) + unc-119(+)]. Carries integration of nuo-1(T434M) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Site of integration unknown. Moderate brood size. Shorter life span. Sensitive to oxidative stress.

uaEx27 [(p016bA443F) nuo-1(+) + unc-119(+)]. Contains an extrachromosomal array carrying nuo-1(A443F) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Low brood size. Short life span. Sensitive to oxidative stress.

DEET-resistant. ejd2 causes a F48V substitution in nstp-3. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123.

DEET-resistant. ejd3 causes a P314S substitution in str-217. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123.

DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA

ldIs3 [gcs-1p::GFP + rol-6(su1006)]. Rollers. Reference: Wang J, et al. PLoS Genet. 2010 Aug 5;6(8). pii: e1001048.

ayIs9 [egl-17p::GFP + dpy-20(+)]. Reference: Tamayo JV, et al. BMC Genomics. 2013 May 4;14:304. doi: 10.1186/1471-2164-14-304. PMID: 23642123. lqIs221 is a Pegl-17::mab-5::gfp transgene. ayIs9 is a Pegl-17::gfp transgene. AQR migration defects. AQR in the tail in the normal position of PQR.

lqIs221 [egl-17p::mab-5::GFP + gcy-32p::CFP]. AQR migration defects. AQR in the tail in the normal position of PQR. CFP expression in AQR, PQR and URXL/R. Reference: Tamayo JV, et al. BMC Genomics. 2013 May 4;14:304. doi: 10.1186/1471-2164-14-304. PMID: 23642123.

Dpy. AQR and PQR migration defects. Body wall muscle defects. etr-1(lq61) is a premature stop in alternatively-spliced exon 8. Reference: Ochs ME, et al. G3: Genes Genomes, Genetics. 2020 Jul 7;10(7):2365-2376. doi: 10.1534/g3.120.401182. PMID: 32398235

Dpy. AQR and PQR migration defects. Body wall muscle defects. etr-1(lq133) is 2 bp deletion frameshift in alternatively-spliced exon 8. Reference: Ochs ME, et al. G3: Genes Genomes, Genetics. 2020 Jul 7;10(7):2365-2376. doi: 10.1534/g3.120.401182. PMID: 32398235

lqIs294 [unc-25p::myr::unc-5 + gcy-32p::YFP]. VD/DD axon guidance defects. YFP expression in AQR, PQR and URXL/R. Reference: Norris AD, et al. Development. 2014 Nov;141(22):4395-405. doi: 10.1242/dev.110437. PMID: 25371370.

juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.

juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.

rcSi1 [mex-5p::rpt-1::mCherry + unc-119(+)] II. RPT-1::mCherry allows visualization of the proteasome in the germline. Reference: Sampuda KL, et al. BMC Cell Biol. 2017 Apr 19;18(1):18.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. avIs116 [pie-1p::GFP::ubiquitinAA + unc-119(+)]. GFP::ubiquitinAA is visible in the germline when raised at 25C. GFP::ubiquitinAA is a mutated form of ubiquitin that has a dialanine at the C-terminus instead of the diglycine required for conjugation onto protein substrates. Useful control strain for LN130. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Sampuda KL, et al. BMC Cell Biol. 2017 Apr 19;18(1):18.

cp21[hmr-1::GFP + LoxP] I. GFP inserted at the C terminus of endogenous hmr-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

N-terminally tagged GFP::CHE-12. Cilia are slightly shorter than WT. GFP fluorescence appears in multiple sensory cilia in the head and phasmid neuron cilia in the tail. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.

Entire che-12 coding sequence deleted and replaced with GFP. This produced a phenotype that is more penetrant than that reported for the original che-12 strain, which introduced a nonsense mutation midway through the coding region. Short amphid and phasmid cilia. Defective chemotaxis to NaCl. Dye-filing defective. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.

cp20[hmp-1::gfp + LoxP] V. GFP inserted at the C terminus of endogenous hmp-1 gene by Cas9-triggered homologous recombination. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

cpIs56 [mex-5p::TagRFP-T::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

C-terminally tagged CHE-12::GFP. Cilia are slightly shorter than WT. GFP fluorescence appears in multiple sensory cilia in the head and phasmid neuron cilia in the tail. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.

cp65[mrck-1::YPet + LoxP]. YPet inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. Yellow fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

cpIs53 [mex-5p::GFP-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cpIs54 [mex-5p::mKate::PLC(delta)-PH(A735T)::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cpIs55 [mex-5p::mCherry-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cp78[gfp::hmp-2 + LoxP] III. GFP inserted at the N terminus of endogenous hmp-2 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar in the second synthetic intron of GFP. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

cpIs64 [mex-5p::mYPet::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234

Maintain at 15C. Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234

Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234