Search Strains

Superficially wild-type. Deletion removes of wac-1.1/Y40B1A.1 and wac-1.2/Y40B1A.3 (I:13344075 to 13358647, version WS276, PRJNA13758).

3xHA::TurboID tag with GGCG linker sequence inserted at the N-terminus of the endogenous NHR-49 gene (long isoform c). Derived by out-crossing parental strain PHX10203. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catcatcagAATATGGACCCGCGTGTATGTCCAATT Right flanking sequence: CAACATGGACCCAGAGCCCTCAAAAATGGGTCGATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCTGGGTCCATGTTGAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATACACACTTCATTTGGTCATTTGGAAGGTGCAGA Right flanking sequence: GATAGGAGATTATCATTTGTTCAAAAAAATTCCATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATTTGGAAGGTGCAGAGAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1 into sup-45 mutant (sy975); Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. affl-2 formerly known as sup-45.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C18B12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGAAGAAGAATTAGTGCATAAATGTTTGGCGAA. Right flanking sequence: AGGTGGAAATTTTGGAATGGATGTTTCGGATTTTATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATAAATGTTTGGCGAAAGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F09B12.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gaactaaaaattgcagATGAAACGTGTGCCGACG. Right flanking sequence: GTCAATTTCGATGTAGCAATGGAAGGTGTATAACG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTACATCGAAATTGACCGT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

cuc-1 null mutant. Grows well on standard media but has a slightly reduced brood size and ~10% of gonad arms show a migration defect. Reference: Zhang X, et al. Biometals. 2020 Jun;33(2-3):147-157. doi: 10.1007/s10534-020-00239-z. PMID: 32506305.

umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim mKate2 expression in pharynx, and segregate heterozygotes (not paralyzed, dim mKate2), homozygous wild-type (not paralyzed, no mKate2), and hIn1 homozygotes (paralyzed, bright mKate2). Pick non-paralyzed, dim mKate2 worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived by crossing parental strain CGC105 (hIn1[umnIs78]) to RG3173 (Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)]) and selecting for the recombined hIn1 worms.

Gin is Glucose INtolerant. gin-1(cv10) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. Grown on HB101, HT115 or fresh OP50 (seeded less than five days)

Mitani Laboratory allele. Gro, Maternal-effect, diet/nutrition-dependent embryonic lethal. Strain segregates near 100% lethality when grown on glucose, UV-treated OP50, older OP50, and DA837. Lethality is suppressed on fresh OP50 (less than 5 days from seeding), HB101, and HT115.

Maternal-effect, diet/nutrition-dependent embryonic lethal. Strain segregates increased embryonic lethality when grown on glucose, UV-treated OP50, older OP50, and DA837. Lethality is suppressed on fresh OP50 (less than 5 days from seeding), HB101, and HT115.

Gin is Glucose INtolerant. gin-2(cv11) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. 20C, Grown on HB101, HT115 or fresh OP50 (seeded less than five days).

ZK970.6 Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 1545 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01F6.1 Homozygous. Outer Left Sequence: GGTTTTAGGAAACGGCATCA. Outer Right Sequence: AGCGTTACGAATTTTGGCAC. Inner Left Sequence: CTAGCAGGAGTGGTCTTGCC. Inner Right Sequence: GGATCAAAATGGAACATCCG. Inner Primer WT PCR Product: 2438. Deletion size: 1583 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19D2.1. Homozygous. Outer Left Sequence: GAGGAAATCGCGATGAAGAG. Outer Right Sequence: TCTCCGCAGTTTACAGAGCA. Inner Left Sequence: AGAGTTGGCTGTATTTGCGG. Inner Right Sequence: CGGCACATTCTGAAAGTCAA. Inner Primer WT PCR Product: 3298. Deletion size: 1666 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK455.1. Previously called gei-22. Homozygous. Outer Left Sequence: CACACACAAAAACGGACAGG. Outer Right Sequence: TCGTTGCTCCAAATCACAAA. Inner Left Sequence: AGACGAGCTTCCAATCTCCA. Inner Right Sequence: TTCCTCCGTTGCGGTAATAG. Inner Primer WT PCR product: 2984. Deletion size: 540 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08E3.4. Homozygous. Outer Left Sequence: GGATGGACTCGAACCAAAAA. Outer Right Sequence: TTCTGGAGGGTCTCTGCCTA. Inner Left Sequence: TTGCAGGAAACACAACGAAG. Inner Right Sequence: CAAATTTGCCATATGTTGCG. Inner Primer WT PCR product: 2983. Deletion size: 1146 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02D3.1. Homozygous. Outer Left Sequence: TGTTCAAGCGTAACACGACC. Outer Right Sequence: AAACCATTTGGATTGCCGTA. Inner Left Sequence: CAGATGTCTGCCGCTGTAAC. Inner Right Sequence: TTCAACACAACCAAATCCGA. Inner Primer WT PCR product: 3055. Deletion size: 923 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08B6.4. Homozygous. Outer Left Sequence: AACACAACGAGGGACCTGAC. Outer Right Sequence: TGAACGCATCTGGATCATGT. Inner Left Sequence: GAGTCGGGGAAAAAGGGATA. Inner Right Sequence: GGTCGACCTAATGGAGACCA. Inner Primer WT PCR product: 2177. Deletion size: 1624 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.12. Homozygous. Outer Left Sequence: GAGAAAGTGAGCTCCGCAAT. Outer Right Sequence: GCCTACAAAAATGCCATTCG. Inner Left Sequence: ATCACATCGAGGCAAGCTCT. Inner Right Sequence: CAATCGATACAAGCAGCCAA. Inner Primer WT PCR Product: 2693. Deletion size: 635 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C11.5. Homozygous. Outer Left Sequence: GAACGGCCTATGGTGACACT. Outer Right Sequence: TGAGCAGAACGAAAGGAGGT. Inner Left Sequence: GACAATTGTTTTTGGACGGG. Inner Right Sequence: CCGAGCAAATTTGGAAACAT. Inner Primer WT PCR product: 2642. Deletion size: 1680 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48C3A.14 [Merged Y48C3A.15 in to this gene based on BLASTX homologies.] Homozygous. Outer Left Sequence: GACACCCTTGGTGTTCAGGT. Outer Right Sequence: ATCACTTTTCCTCGGGGAGT. Inner Left Sequence: TTGTGGCGACTCTGATGAAG. Inner Right Sequence: ACGAACATTTGAATTTCCCG. Inner Primer WT PCR Product: 2998. Deletion size: 2275 bp; includes insertion of approximately 1150 bp at break. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK970.6. Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 2542 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11C7.4 Homozygous. Outer Left Sequence: TGAATCTTTGCAATTCGTGG. Outer Right Sequence: CTTGGTGTTCAACATGACCG. Inner Left Sequence: ATTGGCAAACGATTTTCTCG. Inner Right Sequence: CAGTCAACGGACAGCTTGAA. Inner Primer WT PCR Product: 3232. Deletion size: 843 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0348.4a Homozygous. Outer Left Sequence: ACATCCGGAGCTAAAGCAGA. Outer Right Sequence: CGCCGAGAAAGCAATAGAAC. Inner Left Sequence: TGCTACCTATTGGGTTTCGG. Inner Right Sequence: TGGCCGAGTTTTCTCATCTC. Inner Primer PCR Length: 2928. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 1620 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09A12.4. Homozygous. Outer Left Sequence: GGTATCTGCCTTGTTCTGCC. Outer Right Sequence: GAAACGATGCTCATGCTCAA. Inner Left Sequence: AACCGCGAACAACGAGTTAC. Inner Right Sequence: CAGGGGAACCGCTAGACATA. Inner Primer WT PCR product: 3091. Deletion size: 1317 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43E11.6. Homozygous. Outer Left Sequence: ATCGCAATTTTCTCCATTCG. Outer Right Sequence: GCGTACTTCTTTCGGAGTGG. Inner Left Sequence: TATTCCGATTCCACACAGCA. Inner Right Sequence: CGATGCGTCAATTTATGTGG. Inner Primer WT PCR Product: 3254. Deletion size: 1032 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27A10.7. Homozygous. Outer Left Sequence: TCCATGCGAATTGTTGAAAA. Outer Right Sequence: ATCCGCATCTGAATGAGCTT. Inner Left Sequence: TGTCTCCACTGCTAACACGC. Inner Right Sequence: CCGCCCATCAAAAAGATAAA. Inner Primer WT PCR product: 2628. Deletion size: 1242 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 712 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26D10.4. Homozygous. Outer Left Sequence: GTTACTGAATTGCCGTGCCT. Outer Right Sequence: CAAAAGTGTACCGCTGGGTT. Inner Left Sequence: AAAAATCACGAGATTCCGCA. Inner Right Sequence: CATCATCATTGATCGCTTGG. Inner Primer WT PCR Product: 3275. Deletion size: 1473 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38A10A.5. Homozygous. Outer Left Sequence: TATGGCACTTCGTCAGATGG. Outer Right Sequence: CATTGTCGTAGCAGACGAGC. Inner Left Sequence: TGTCGAGAGGAATCGATGTG. Inner Right Sequence: TTTGCTCTTGTTCGGTTTCA. Inner Primer WT PCR product: 2134. Deletion size: 1287 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A5.2. Homozygous. Outer Left Sequence: AATGCTGGCGTTCTCTGTCT. Outer Right Sequence: TGCTGCCTATCGTGAGTTTG. Inner Left Sequence: TGAAATGGAGGATCCCTGAG. Inner Right Sequence: ATTTCGTGTGGGAAATTGGA. Inner Primer WT PCR product: 2183. Deletion size: 1109 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49C8.4. Homozygous. Outer Left Sequence: CCCCTTGTGCTACGAAAAGA. Outer Right Sequence: CTCCCTTTTCTGACCTGCTG. Inner Left Sequence: AGGTTACGGTATCGGTGCTG. Inner Right Sequence: TTCACTGGCGTGTATTTTGG. Inner Primer WT PCR product: 2871. Deletion size: 1439 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01B10.1. Homozygous. Outer Left Sequence: TTGTTTGAACATCTCGCTGC. Outer Right Sequence: CGGTTTTGGGAGGATGAATA. Inner Left Sequence: TTGGGGCTCACTCTCACTTT. Inner Right Sequence: CCGTAGGGGTGCAAAACTAA. Inner Primer WT PCR product: 3101. Deletion size: 789 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26E6.9a. Homozygous. Outer Left Sequence: TATAGGTCCCCATGGAGCTG. Outer Right Sequence: GGCCTGAATCAAGAAATGGA. Inner Left Sequence: TGCACGGTGAATGATCAAAT. Inner Right Sequence: CATCGGGAAGCTCTTCTGTC. Inner Primer WT PCR product: 3324. Deletion size: 1269 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03E9.3. Homozygous. Outer Left Sequence: AAAATGGCGAAAGGGCTAGT. Outer Right Sequence: CGGAACTACGGTAAATGCGT. Inner Left Sequence: GCCGACATTTTGGAAAAGAA. Inner Right Sequence: TTTTGCCGTTCTAGGTGTCC. Inner Primer WT PCR product: 2667. Deletion size: 1196 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03E9.3. Homozygous. Outer Left Sequence: AAAATGGCGAAAGGGCTAGT. Outer Right Sequence: CGGAACTACGGTAAATGCGT. Inner Left Sequence: GCCGACATTTTGGAAAAGAA. Inner Right Sequence: TTTTGCCGTTCTAGGTGTCC. Inner Primer WT PCR product: 2667. Deletion size: 832 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E03G2.2. Homozygous. Outer Left Sequence: GCCTGAGATCAACGACTTCC. Outer Right Sequence: CACAAACTATTGGTGTGGCG. Inner Left Sequence: TGTCTTTTGCGAGTCGATTG. Inner Right Sequence: TGTCAAGTTGTCTGCTTGGG. Inner Primer WT PCR Product: 3071. Deletion size: 658 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK829.2. Homozygous. Outer Left Sequence: TCTCGGCATGTTGTTAGCTG. Outer Right Sequence: TTGGCTGCTGTTCTGATACG. Inner Left Sequence: TGAAGAGGAAGCTTTTGGGA. Inner Right Sequence: CCGGAAAAGTCTTGATTGGA. Inner Primer WT PCR Product: 3232. Deletion size: 895 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49C3.1 Homozygous. Outer Left Sequence: CTATTGTCAGGGACTCGGGA. Outer Right Sequence: TGACATGTTTCCACGGCTTA. Inner Left Sequence: CTGGAGATTTCCGACGAGAG. Inner Right Sequence: CGGGGGTATAGTGGGCTAAT. Inner Primer PCR Length: 3002. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13F2.1. Homozygous. Outer Left Sequence: AAATACGGTCTTGACACGCC. Outer Right Sequence: CAGGCATTGCGCCTATAAAT. Inner Left Sequence: CGCACACCTTTGCTCATTTA. Inner Right Sequence: AAACAGTAAGCGCATCCACC. Inner Primer WT PCR product: 3114. Deletion size: 715 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32E12.3. Homozygous. Outer Left Sequence: CGAATATTCCCGAAAAACGA. Outer Right Sequence: CCACGACTTCTCCCTTTCAA. Inner Left Sequence: AATCCCAGTGCAGGCATATC. Inner Right Sequence: ATTTCCAGCACCATTATCGG. Inner Primer WT PCR product: 2824. Deletion size: 983 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.12. Homozygous. Outer Left Sequence: CGGATTGTCCACTTGAGACC. Outer Right Sequence: TGAAGCAATTTTGTTCAGCG. Inner Left Sequence: GTACGAAGCCGTTCAAAAGC. Inner Right Sequence: GGAGAAGAATGGAACCGTGA. Inner Primer WT PCR product: 3027. Deletion size: 2510 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22D3.2. Homozygous. Outer Left Sequence: CTTGCCAAATTTGATTGGCT. Outer Right Sequence: ACCAACTTGGCATTTTTCCA. Inner Left Sequence: ACGGTCTCTCGTGTTCTCGT. Inner Right Sequence: TCCGATAACTTCTCGCCAGT. Inner Primer WT PCR Product: 2887. Deletion size: 817 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09G4.1. Homozygous. Outer Left Sequence: CATAGGCGGTCTAGGAGCAG. Outer Right Sequence: ATGGCGAGCTTTTCTGTCAT. Inner Left Sequence: GCCCCGTAAATAAGCACAAA. Inner Right Sequence: TCGTGTTCTTTCACGTCTCG. Inner Primer WT PCR Product: 2824. Deletion size: 863 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M04F3.4. Homozygous. Outer Left Sequence: GCGAGAAACTGAAGTCGGTC. Outer Right Sequence: ATCCAGCACATCCACAACAA. Inner Left Sequence: GTCAGGAACTGCTCGTAGCC. Inner Right Sequence: ATGGTCAAGCTTCAGCGACT. Inner Primer WT PCR Product: 2480. Deletion size: 328 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09G4.2. Homozygous. Outer Left Sequence: TCCAGTGCCTATTTTCTGGG. Outer Right Sequence: TCATTTCGGTGCAAAATTCA. Inner Left Sequence: CATTGAGTTCAAGCCGTTCA. Inner Right Sequence: CTTCTTCCGGATAACCACCA. Inner primer WT PCR product: 2924. Deletion size: 1192 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807