More Fields
Strain Species Genotype
PS3233 C. elegans affl-2(sy509) III. Show Description
Defects in egg laying. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RB2614 C. elegans Y55B1BR.2(ok3639) III. Show Description
Y55B1BR.2 Homozygous. Outer Left Sequence: gtggcgtcagagtgtctcaa. Outer Right Sequence: taatcctaaggcaaagccca. Inner Left Sequence: ggtggagagacgcagagttc. Inner Right Sequence: ccaaagcctaagcctgagc. Inner Primer PCR Length: 1323. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
PS8203 C. elegans affl-2(sy975) Y55B1BR.1(sy1220) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1 into sup-45 mutant (sy975); Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. affl-2 formerly known as sup-45.