Search Strains

C17E7.5. Homozygous. Outer Left Sequence: TTCTTGTGCGAAAAATTCCC. Outer Right Sequence: TATGCACCAAACACGCAAAT. Inner Left Sequence: CTCAGACAACTGTGGCGAAA. Inner Right Sequence: ATTGCGCAACGTGAATTTTT. Inner Primer PCR Length: 3294 bp. Deletion Size: 1242 bp. Deletion left flank: AAAACTCCATAAAAATTACCTTTTTAAAAA. Deletion right flank: ACACAGTAGTGTTTAAGCAAGATTTTCTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22E10.4. Homozygous. Outer Left Sequence: GATCTCGAACCAACGCTCTC. Outer Right Sequence: TGGAGTCGCAATGCTTGTAG. Inner Left Sequence: CCTTCTCTCCGACGTCAGTC. Inner Right Sequence: CGTTGCACCCACTTGTATTG. Inner Primer WT PCR product: 3156. Deletion size: 2256 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71F9AL.18. Homozygous. Outer Left Sequence: GTCGGTGTACGGCATTCTTT. Outer Right Sequence: TCATTTTTGGGGGATTTCAG. Inner Left Sequence: TCCCAGAGAAGATCGGATTG. Inner Right Sequence: AAAGAATCGAATCGCAAAGC. Inner Primer WT PCR Product: 2473. Deletion size: 1007 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25B5.1. Homozygous. Outer Left Sequence: TTTTCAGTCGCCCAATTACC. Outer Right Sequence: ATCATTCAATCCCTTGTGCC. Inner Left Sequence: GGCAGAGGAAGAAGTTGTCG. Inner Right Sequence: TCGTGTTGTCCAGTGAGGAG. Inner Primer WT PCR product: 2735. Deletion size: 1956 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47H9C.2. Homozygous. Outer Left Sequence: GAGTGAGTTGGTAGCTCCGC. Outer Right Sequence: TGGTGCATCGATCGAAATTA. Inner Left Sequence: GCCACGTGTCGATAACATTG. Inner Right Sequence: CCATGAATCTTTGACGGCTT. Inner Primer PCR Length: 2844 bp. Deletion Size: 890 bp. Deletion left flank: GGTGCGGTCCACGGCTGGTCCCTATATATT. Deletion right flank: ACTATAACAAAAAGAAAACAAATACATTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54D1.1. Homozygous. Outer Left Sequence: AGCTCTTCACTTCCGCGATA. Outer Right Sequence: GTGGCGTTGTACATTCGTTG. Inner Left Sequence: TGGTAGTGGAAAAAGCACCC. Inner Right Sequence: ACCCGGAAGGTCCTACAAGT. Inner Primer WT PCR product: 3218. Deletion size: 2060 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53F4B.2. Homozygous. Outer Left Sequence: GAATGAGGCGTAGATTCCGA. Outer Right Sequence: ATTTTCAGCATGCGACCTCT. Inner Left Sequence: TTGTTGGCACATCTGGAAAA. Inner Right Sequence: TCTCACGAAAAACCAGGTGA. Inner Primer WT PCR Product: 3162. Deletion size: 1227 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21E8.2&T21E8.1. Homozygous. Outer Left Sequence: GCTGCAGATCCAGCCATATT. Outer Right Sequence: AAGTGACAACAGCAAACCCC. Inner Left Sequence: AGCACCCTGAACGATATTGG. Inner Right Sequence: ACGTTGGAGACAACACGACA. Inner Primer WT PCR product: 3265. Deletion size: 8345 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06B3.8. Homozygous. Outer Left Sequence: CCTAACAACGAACACGGCTT. Outer Right Sequence: GCATTCGGCAATTGGTTATT. Inner Left Sequence: ACACGCACCAATCAACTGAA. Inner Right Sequence: GCGAAGATACGTGGACACAA. Inner Primer WT PCR Product: 3151. Deletion size: 1988 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C48B4.2. Homozygous. Outer Left Sequence: CCCATCGAGAGAATTGGAAA. Outer Right Sequence: ATGCGTGAAGGAAAACCTGT. Inner Left Sequence: CGGAGATGAACAGAGCACAA. Inner Right Sequence: CAGATGAGCAAATGCAAAGG. Inner Primer WT PCR product: 2823. Deletion size: 530 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15C11.2a. Homozygous. Outer Left Sequence: AGCTGCTCTTGAACGGTTGT. Outer Right Sequence: TGAATAAAAGGGGAACGTCG. Inner Left Sequence: CAGGAGCCCTTGCTCAATAG. Inner Right Sequence: GCTTATTAAAGGGGCCGAAG. Inner Primer WT PCR product: 2991. Deletion size: 1147 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C29E6.2. Homozygous. Outer Left Sequence: TCGGCTCTCTTTTCCTGTGT. Outer Right Sequence: GGTACACCGAAGTGCCATCT. Inner Left Sequence: GCTGGAATTGGAAGGATTGA. Inner Right Sequence: TCGTGACACTACCATTCCCA. Inner Primer WT PCR Product: 3280. Deletion size: 1334 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05F9.10, R05F9.1b. Homozygous. Outer Left Sequence: TTGTAAGGGGAAATTCTGCG. Outer Right Sequence: TGACGAGGGACACACAAAAA. Inner Left Sequence: AGGAGATTGGCGGAAGAGAT. Inner Right Sequence: AGTCGCAGGTTTAGCTCCAA. Inner Primer WT PCR Product: 3317. Deletion size: 2275 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37H9A.6. Homozygous. Outer Left Sequence: CATATTGCCCAGAAATGGCT. Outer Right Sequence: CCGAGAAGCTTTTGCTCTGT. Inner Left Sequence: AGTGGCAAAAATGGCAAAAA. Inner Right Sequence: GATTTGAAGCCCAAAGAGCA. Inner Primer WT PCR Product: 2133. Deletion size: 785 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R57.1. Homozygous. Outer Left Sequence: GACCCCAACCAATATCATGC. Outer Right Sequence: TGGATACGTGTCCCATGTTG. Inner Left Sequence: CGTTTCGGTTTCAAAGTGGT. Inner Right Sequence: TGAAGTTGATCACCGGAACA. Inner Primer WT PCR Product: 2805. Deletion size: 1523 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1236.2. Homozygous. Outer Left Sequence: AATTGTAGAACCATGGCCGA. Outer Right Sequence: AACATGTGCAACAATTCCGA. Inner Left Sequence: CGTTCGGTTTGAGATGGATT. Inner Right Sequence: AGATGAGAGGCGCAGACATT. Inner Primer WT PCR Product: 2703. Deletion size: 2221 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10G8.8. Homozygous. Outer Left Sequence: ACCACTTTTTCACGGACCAG. Outer Right Sequence: GCCATCACCCTCTCTTTTCA. Inner Left Sequence: CTTCTCAACTCGCTCCATCC. Inner Right Sequence: CTCATTCGGGAAAAGAACCA. Inner Primer WT PCR Product: 3004. Deletion size: 1524 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F02E11.1. Homozygous. Outer Left Sequence: ATGGTAGCGAGAAGGGAAGG. Outer Right Sequence: CGAAAAGAACGGGAAAATCA. Inner Left Sequence: CAGGAAGGAGGTGATCAGGA. Inner Right Sequence: TGACACGAATCTTCAAAGCG. Inner Primer WT PCR Product: 2485. Deletion size: 2082 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H01A20.1. Homozygous. Outer Left Sequence: CCCTGTATTCCTCGCATTGT. Outer Right Sequence: GGACAAACACGAGACCGAGT. Inner Left Sequence: TTGATGGCCTGTCATCTGAA. Inner Right Sequence: CCCGTCACAATGAAACACTG. Inner Primer WT PCR Product: 3070. Deletion size: 1296 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07E5.15, R07E5.17. Homozygous. Outer Left Sequence: TCACGGTCATCGATTGGTTA. Outer Right Sequence: TGGCCCGGTATCACAATAAT. Inner Left Sequence: CTTGAAAAGCAACTCGGACC. Inner Right Sequence: CGGAAAATTCGACCAGAGAA. Inner Primer WT PCR Product: 2236. Deletion size: 992 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F5.3 Homozygous. Outer Left Sequence: AGCGGGATCAATTCCTTTCT. Outer Right Sequence: TATGCAACGTCTTTTGGCAG. Inner Left Sequence: CGGATGCGTTTGGTATTTCT. Inner Right Sequence: TCATTCGGGAGGAACGATAC. Inner Primer PCR Length: 3234. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M04G12.3 Homozygous. Outer Left Sequence: GAGCTACCGCTCCACTTTTG. Outer Right Sequence: CGAGCAACTTGAAACGATGA. Inner Left Sequence: AAGTTTTCAGCTTCTGGGCA. Inner Right Sequence: TGAGCCATGCGAGTATGAAG. Inner Primer PCR Length: 3062. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59E12.13 Homozygous. Outer Left Sequence: GAAAGTTCCAATGGGCTCAA. Outer Right Sequence: TCAACATTTTGAGCAGACGC. Inner Left Sequence: TCGTTGTCAAACCATTTCCA. Inner Right Sequence: TTGAAACCGCCAAGTGATTT. Inner Primer PCR Length: 3345. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28B8.5 Homozygous. Outer Left Sequence: TGTGCTAGCTTTCCAAACCC. Outer Right Sequence: GATGGGTGTATTTTGGACCG. Inner Left Sequence: CCTGGAAGGCATTTTTGTGT. Inner Right Sequence: TTCACGGATTTTTCGTGTTG. Inner Primer PCR Length: 3066. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y52B11A.4 Homozygous. Outer Left Sequence: ATAGGCGGAGCTTAAACGGT. Outer Right Sequence: CTGATTTTTCCAGAGTCCGC. Inner Left Sequence: CGTCGCCAATTTTTGAATTT. Inner Right Sequence: TGGTGACTCATTCCGTCGTA. Inner Primer PCR Length: 2468. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M163.3 Homozygous. Outer Left Sequence: GAGGACTCGCACAGTCATCA. Outer Right Sequence: TTCATTTGAGCAATTGAGCG. Inner Left Sequence: TTTCAAGTGTCACCCAACCA. Inner Right Sequence: CCATCCGTGCAAAGTTTCTT. Inner Primer PCR Length: 2807. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28F3.1 Homozygous. Outer Left Sequence: ACAAGGAATTGGCGGAATTT. Outer Right Sequence: TTGAACGCTAAACAACACGC. Inner Left Sequence: TAGGCGGTGCAGAAGCTATT. Inner Right Sequence: GGAGCATCGTTGTTTCGTTT. Inner Primer PCR Length: 3197. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48E3.1 Homozygous. Outer Left Sequence: TTTCATCTCTGGTTCTCGGG. Outer Right Sequence: GGTCGGAGTTTGCACATTTT. Inner Left Sequence: CTAGCCGCATTCTTCTTTGG. Inner Right Sequence: TCCAATCGTTTCTTCCATCC. Inner Primer PCR Length: 2828. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20B6.3 Homozygous. Outer Left Sequence: GTTGCGAACCTAGGCATTGT. Outer Right Sequence: TCGGAAATGGATCTCTGGAC. Inner Left Sequence: TCTGGATGCAAGCATCTGTC. Inner Right Sequence: CGCCACCATCTCCAGTAAAT. Inner Primer PCR Length: 3296. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14F3.3 Homozygous. Outer Left Sequence: GGAGCGAGAAAATGGTTTTG. Outer Right Sequence: GCAGTCATCGCATTCCTTTT. Inner Left Sequence: GATGCAAAGGGCGAAAATAA. Inner Right Sequence: TAGTAATGCGTCCGCAAACA. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10D11.1 Homozygous. Outer Left Sequence: ACTGCTCGACAGACTCCGAT. Outer Right Sequence: GACGCATTCACCAACAAATG. Inner Left Sequence: TCGAGGCTGGAACTTCAACT. Inner Right Sequence: CCCCTAATAACTGCACCGAA. Inner Primer PCR Length: 2320. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42A9.1a Homozygous. Outer Left Sequence: CACCAACTCCTGGAGCAACT. Outer Right Sequence: AATCTCATGACTGGGGCAAG. Inner Left Sequence: TGAGCCATCGACTGCTTATG. Inner Right Sequence: CGGCGTTGGTAGTTTTCAGT. Inner Primer PCR Length: 3388. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y69A2AR.4 Homozygous. Outer Left Sequence: TTCAGCTTGTCAAGGGCTTT. Outer Right Sequence: CTTCCATTGGGGAAGTTTGA. Inner Left Sequence: CCCAAAGTGATCGGAACCTA. Inner Right Sequence: GGGATTATTTGGACCCGACT. Inner Primer PCR Length: 2195. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11H6.1 Homozygous. Outer Left Sequence: CTTCGATGAGACAGCCACAA. Outer Right Sequence: TTACTGGAAGTTTCCCCGTG. Inner Left Sequence: CAACGGCAACAAGATTAGGG. Inner Right Sequence: GTGAAGCAGTGGCAATTCAA. Inner Primer PCR Length: 2301. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45B8.2 Homozygous. Outer Left Sequence: AAACCACAGGGTCTGACAGG. Outer Right Sequence: CTTGCGCGACATCAAAAGTA. Inner Left Sequence: GGCATGTTCACTCGGAATTT. Inner Right Sequence: CGTTTGTGCAGAGTGAAGGA. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10G3.5 Homozygous. Outer Left Sequence: GCTTCCAATTCTCTTGCTCG. Outer Right Sequence: ATTTAAGCGGAACAGCCTCA. Inner Left Sequence: TGAACTGCGTCTTCAATTCG. Inner Right Sequence: GAAATCAGAGGGAATCCGGT. Inner Primer PCR Length: 2757. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK757.3 Homozygous. Outer Left Sequence: GGATTTGGTCCGAAGTAGCA. Outer Right Sequence: GCCGATGATCAAGGATCTGT. Inner Left Sequence: GAGTTGGAATGGAGACCGAA. Inner Right Sequence: CAATATGCGTGAGGTGGTTG. Inner Primer PCR Length: 2888. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04C9.1. Homozygous. Outer Left Sequence: AGTCCTTGGGTCTCACAACG. Outer Right Sequence: ACGATTTGTTCCTGCCAATC. Inner Left Sequence: CCGTGAAAAAGTACGCGTTT. Inner Right Sequence: GCACTCTAAACACTTCCGGC. Inner Primer PCR Length: 2570 bp. Deletion Size: 1678 bp. Deletion left flank: ACACGGGACAAGTCATCGCTACCGTGGTCG. Deletion right flank: GCGTCAATTTCGGTTCGACAAATCGTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53F8.1 Homozygous. Outer Left Sequence: GTTACTGTTTGCCCATGCCT. Outer Right Sequence: CGTCTTGTTCATCCGTTTCA. Inner Left Sequence: GAAATGCCCAAAAGTGTCGT. Inner Right Sequence: CTCGAAAATTTCCTGGAGCA. Inner Primer PCR Length: 3195. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12G11.2 Homozygous. Outer Left Sequence: TGTCAGGTGGAATACGACGA. Outer Right Sequence: ACATATTCCGAAAAGTGCCG. Inner Left Sequence: TGTTCCATTCACTTCCGTCA. Inner Right Sequence: TGCACGTACACATTCTGCAA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27C8.5 Homozygous. Outer Left Sequence: AGATTGCGTCTGTGTGATCG. Outer Right Sequence: CTAGAGAAAGGTGCATCGGC. Inner Left Sequence: CGCGGCTTCACAAATAAAAT. Inner Right Sequence: AGAACCTCTTTTCCGGTGGT. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52F12.1 Homozygous. Outer Left Sequence: TATCGGAGTGTCGATGCAAG. Outer Right Sequence: CAGCCTACCTTCGTGCCTAC. Inner Left Sequence: GATTCTCGTTTCTTGGCTGC. Inner Right Sequence: GCAAGAGGCAGGCATAGTTC. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B10.1a Homozygous. Outer Left Sequence: GCAATCAAAGTTTCCAGCGT. Outer Right Sequence: CCTTGTCCTACTCAGCCAGC. Inner Left Sequence: AGATAAAGTCGGCAACCTGC. Inner Right Sequence: CAAATGGCGATCTGTACCCT. Inner Primer PCR Length: 3224. Estimated Deletion Size: about 1900 bp. From Nathalie Pujol 11/04: breakpoints, with a 8 bases insertion, AAATGTCGCCGGATCGTGAACTTGCAAGAAT/AGAATAAA/TGTAGACAGTGCTGGCGT AATTCGCCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09F10.4 Homozygous. Outer Left Sequence: TTGCAAGCATTATTTGCGAG. Outer Right Sequence: ATTCCATTTTCCCATCCTCC. Inner Left Sequence: GGCAGCTTGACACAATTGAA. Inner Right Sequence: TTATTGCCGGTGGTTCTGAT. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03D10.1 Homozygous. Outer Left Sequence: TTTTCCGGAAGATTCCAGTG. Outer Right Sequence: AAAAATGCGGGAATGTTTTG. Inner Left Sequence: GCTGAAAAATCGTGGGAAAA. Inner Right Sequence: CCCATTTTCTTTTGCAGGAA. Inner Primer PCR Length: 2786. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01B7.4 Homozygous. Outer Left Sequence: AAAGACCGGGGAGAGATGAT. Outer Right Sequence: GCATATTCTTTTTGGCGCTC. Inner Left Sequence: TAGCACGCTGTCCATGTAGC. Inner Right Sequence: TTGACTCATACGCCCAATCA. Inner Primer PCR Length: 3137. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08H2.6 Homozygous. Outer Left Sequence: CCGACATAGGTTTGCACCTT. Outer Right Sequence: CGAAGTGGAATTGGTGGTCT. Inner Left Sequence: CAAGATGCTCCGTTGTTTCA. Inner Right Sequence: GGAGTCGGGAATCAGTCAGA. Inner Primer PCR Length: 2728. Upper breakpoint flanking sequence: TTCGGATTTGAAAGAGTCTGAAAAAGAT. Lower breakpoint flanking sequence: TTGAACTGTAGTCTTTGCTACTTCTT. Deletion Size: 1948 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.2 Homozygous. Outer Left Sequence: TTTTTACGGGCGAAATTCAG. Outer Right Sequence: AATTCAGTGATGACACGGCA. Inner Left Sequence: AATTTGTCGATGCACCATGA. Inner Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Primer PCR Length: 2358. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y64G10A.7 Homozygous. Outer Left Sequence: AAAGACCGGACCACTTTGTG. Outer Right Sequence: AACTCACGTTGGACCGAATC. Inner Left Sequence: GTGCGCACACTTGTTCTTGT. Inner Right Sequence: CGATTGACATGCAATTTTCG. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E02H1.2 Homozygous. Outer Left Sequence: TTTTCCAAGGTGGACCAAAG. Outer Right Sequence: CTTTTCTCGACGGCTTCAAC. Inner Left Sequence: TTGCTAGGGAGCATCCAAGT. Inner Right Sequence: CCCAATACAACCAGCAACAA. Inner Primer PCR Length: 2359. Estimated Deletion Size: about 350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807