Search Strains

csEx63 [(pMS88) hsp16-41::torso^4021-Draf + (pTG96) sur-5::GFP]. Pick GFP+ to maintain. Muv phenotype in GFP+ after heat shock during larval stage. References: Kao G, et al. Development. 2004 Feb;131(4):755-65. Rocheleau CE, et al. Proc Natl Acad Sci U S A. 2005 Aug 16;102(33):11757-62.

csEx72[hsp::lin-45ED + sur-5::GFP]. Maintain by picking GFP+.

nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Pick GFP+ to maintain. Segregates GFP+ Egl animals carrying nEx1187 (mir-35 rescuing array) and GFP- animals that develop as XX pseudomales. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

uthIs372 [sur-5p::pat-10::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.

uthEx556 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthIs235 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.

rmIs284 [F25B3.3p::Q67::YFP]. uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

zcIs4 [hsp-4::GFP] V. uthIs269 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. ER stress resistence. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47.

gpIs1 [hsp-16.2p::GFP]. artEx35 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick animals with red pharynx to maintain. Inducible GFP fluorescence after >1 hour heat shock. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.

eEx512 [dpy-31(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal dpy-31 mutant rescued by array containing dpy-31(+) 6.5 kb fragment. Reference: Novelli et al. (2004) PMID: 15579684.

eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. Nearly inviable, severely dumpy bus-8 mutant rescued by array. Reference: Partridge et al. (2008) PMID: 18395708.

eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(e2892) animals are viable on Leucobacter Verde1, unlike most other bus-8 mutants. References: Partridge et al. (2008) PMID: 18395708. Stroud et al (in preparation).

nbEx146 [glf-1p::glf-1(+) + sur-5p::GFP]. Pick GFP+ animals to maintain. Array rescues glf-1(null) mutant. Reference: Novelli et al. (2009) PMID: 19751718.

eEx754 [ilys-3p::ilys-3::mCherry::unc-54 3'UTR + sur-5p::GFP]. Pick GFP+ to maintain. Translational reporter for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

eEx763 [bus-8(exonU2stop) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal bus-8 mutation rescued by bus-8 transgene defective in 5' exons U1 and U2. Reference: Stroud et al (in preparation).

eEx763 [bus-8(exon2stop) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(ok1175) rescued by modified bus-8(+) transgene. Reference: O'Rourke et al (in preparation).

eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Him. Lethal 1118bp deletion allele of ptr-15 rescued by eEx730. Non-GFP animals will be dead eggs and dead hatchlings. References: O’Rourke et al. (in revision 2024), Kuwabara et al. (in prep.)

eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lon. Non-GFP animals will mostly be dead eggs and dead hatchlings, but can segregate rare GFP-negative viable ptr-15 lon-3 homozygotes (which are fertile but grow very poorly). Reference: Kuwabara et al. (in prep.)

crEx498 [dpy-14p::ptr-15(+) + sur-5p::GFP]. Pick animals with nuclear GFP throughout body to maintain. Lethal ptr-15 deletion allele marked with pharyngeal GFP [loxP ::myo-2p::GFP::unc-54 3’UTR + rps-27p::neoR::unc-54 3’UTR::loxP]; lethality rescued by hypodermal expression of PTR-15 form crEx498 array. Non-nuclear GFP animals (only pharyngeal expression) will be dead eggs and dead hatchlings. Derived from parental strain VC4151. References: O’Rourke et al. (in revision 2024).

muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.

muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.

muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.

muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.

muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.

rexEx8 [sur-5p::GFP::halo + mec-7p::mRFP]. Pick fluorescent worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Green fluorescence in somatic cells.

sqEx27 [sur-5p::argk-1::GFP + rol-6(su1006)]. Pick GFP+ Rollers to maintain. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

sqIs32 [sur-5p::argk-1::GFP + rol-6(su1006)]. GFP+ Rollers. Derived by integration of sqEx27 in MAH264. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

wIs51 [SCMp::GFP + unc-119(+)] V. kuEx194 [elt-1(+) + sur-5p::DsRed]. GFP expression in seam cells. Pick DsRed+ animals to maintain. In a daf-12(WT) background, elt-1(ku491) exhibits some precocious fusion of seamcells and gaps in alae. elt-1(ku491); daf-12(rh61rh411) double mutants have more sever heterochronic phenotypes including seamcell proliferation and bursting vulvae. Reference: Cohen ML, et al. PLoS Genet. 2015 Mar 27;11(3):e1005099.

kzIs20 [hlh-1p::rde-1 + sur-5p::NLS::GFP]. Muscle specific RNAi. kzIs20 genotype differs from published data; this information is correct per Hiroshi Qadota.

feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. Rollers. Strain expresses firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C) in the pink-1(ok3538) mutant background. It is rendered bioluminescent when it ingests D-luciferin. References: Lagido, C, et. al. (to be submitted to bioRxiv). Novel HTS platform for the identification of drugs active in the modulation of mitochondrial function in age-related diseases.

feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. Rollers. Strain expresses firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C) in the pink-1(ok3538) mutant background. It is rendered bioluminescent when it ingests D-luciferin. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido, C, et. al. (to be submitted to bioRxiv). Novel HTS platform for the identification of drugs active in the modulation of mitochondrial function in age-related diseases.

csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.

narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. narEx29 [sur-5p::GFP::mpk-1A + myo-3p::RFP]. mpk-1(-) strain with germline MPK-1B rescued by single-copy insertion and somatic MPK-1A rescued by an extrachromosomal array. Pick RFP+ to maintain; narEx29 rescues mpk-1 so array should be stable. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.