Search Strains

More Fields
Strain Species Genotype Add
HBR1901 C. elegans goeIs407. Show Description
goeIs407 [hsp-16.2p::cnc-2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-2::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1902 C. elegans goeIs409. Show Description
goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1907 C. elegans goeIs410. Show Description
goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1911 C. elegans goeIs411. Show Description
goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1912 C. elegans goeIs412. Show Description
goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1914 C elegans goeIs413. Show Description
goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1961 C. elegans goeIs431. Show Description
goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
JK3782 C. elegans qIs56 him-5(e1490) V; qEx557. Show Description
qIs56 [lag-2p::GFP + unc-119(+)] V. qEx557 [hsp-16p::ceh-22b + ttx-3::DsRed]. Him. Pick DsRed+ animals to maintain qEx557 array. Heat-shock can be used to drive the ectopic expression of CEH-22B (derived from Fire Lab vector pPD49.78). LAG-2::GFP is expressed the embryo, nerve cord, Z1/Z4, and DTCs. Reference: Lam N. et al. Curr Biol. 2006 Feb 7;16(3):287-95. doi: 10.1016/j.cub.2005.12.015. PMID: 16461282
KN1510 C. elegans huIs120. Show Description
huIs120 [hsp-16.2p::sfrp-1 + myo-2p::Tomato]. Wild-type under normal culture conditions. Heat-shock (10 min) during embryogenesis causes embryonic lethality and HSN migration defects. Heat-shock (10 min) at hatching causes Ql and QR migration defects. Reference: Harterink M, et al. Development. 2011 Jul;138(14):2915-24.
KN4 C. elegans huIs4. Show Description
huIs4 [hsp-16.2p::pop-1(delta N) + rol-6(su1006)]. Rollers. Truncated pop-1 fragment encoding delta N-POP-1(45-438) driven by heat-shock promotor hsp-16.2. Reference: Korswagen et al. (2000) Nature 406: 527-32.
KN53 C. elegans huIs7. Show Description
huIs7 [hsp-16.2p::Myc::bar-1(delta N) + mec-7p::GFP + dpy-20(+)]. Muv. Posterior migration of the QR descendants. Reference: de Groot et al. (2014) Science Signal. Ra26.
LSD1091 C. elegans smg-1(cc546) I; xchEx91. Show Description
xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LSD1097 C. elegans smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LSD2104 C. elegans xchIs15. Show Description
xchIs15 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C: Prone to transgene suppression at higher temperatures. Rollers. Upon heat shock, human amyloid beta is expressed and secreted into the extracellular space. Aggregates are found in the extracellular space after 16 hours. Generated in N2 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486.
MD4195 C. elegans unc-119(ed3) III; bcSi69 IV. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. [NOTE: MD4195 can be maintained at 20C instead of 15C because it does not carry an array with guide RNAs targeting essential genes.] Generated in parental strain EG8081. Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4571 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1367. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1367 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1367 array contains a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4572 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1368. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4574 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1370. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1370 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-1 locus) + U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1370 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I) and a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MIR260 C. elegans risIs31. Show Description
risIs31 [hsp-16.2p::grh-1b::GFP + unc-119(+)]. Long lived without heat shock. Heat shock induces over-expression of grh-1 causing short-lived phenotype and nuclear GFP expression. Described as "hsp-16.2p::grh-1::gfp OEx line 1" in referenced paper. Reference: Grigolon G, et al. Nat Commun. 2022 Jan 10;13(1):107. doi: 10.1038/s41467-021-27732-4. PMID: 35013237.
MIR276 C. elegans risIs33; gpIs1. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and TJ375.
NFB509 C. elegans zdIs13 IV; vlcEx284. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su1006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NIS1012 C. elegans kytEx1012. Show Description
kytEx1012 [hsp-12.6p(1kb)::hsp-12.6::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Honjoh S, et al. Nature. 2009 Feb 5;457(7230):726-30.
NIS1013 C. elegans kytEx1013. Show Description
kytEx1013 [hsp-12.6p(5kb)::hsp-12.6::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Honjoh S, et al. Nature. 2009 Feb 5;457(7230):726-30.
NL3400 C. elegans pkIs1604. Show Description
pkIs1604 [hsp-16.2::ATG(A)17GFP::LacZ + rol-6(su1006)]. Rollers.
NL3401 C. elegans pkIs1605. Show Description
pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.
NL4807 C. elegans unc-119(ed3) III; pkIs2170 X. Show Description
pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.
NQ570 C. elegans qnIs303 IV. Show Description
qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. When cultivated at 20 degrees, all animals have red nervous systems. Following heat shock, animals are immobile, do not feed, and show green fluorescence in somatic cells. Reference: Nelson MD, et al. Curr Biol. 2014 Oct 20;24(20):2406-10.
NQ792 C. elegans qnIs303 IV; dmsr-1(qn45) V. Show Description
qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. Pumps and moves 2 hours after heat induced flp-13 over-expression. Outcrossed 1x to NQ570. Reference: Iannacone M, et al. eLife 2017.
OH10819 C. elegans unc-3(e151) X; vsIs48; otEx4441. Show Description
otEx4441 [hsp-16.2p::unc-3(cDNA) + ttx-3::mCherry]. vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. Maintain by picking mCherry(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10997 C. elegans otIs264 III; ntIs1 V; otIs305. Show Description
otIs264 [ceh-36p::tagRFP] III. ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. Maintain at 15-20C. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH11053 C. elegans ntIs1 otIs305 otIs355 V. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)] V. otIs355 [rab-3::tagRFP] V. Maintain at 15-20C. Rollers. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH11054 C. elegans pha-1(e2123) III; him-8(e1489) IV; ntIs1 V; otIs305; otEx4445. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. otEx4445 [snb-1::NLS::RFP + pBX]. Rollers. Maintain by picking RFP+ Rollers. Maintain at 20C to maintain extrachromosomal array. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH11117 C. elegans otIs306, otEx4963. Show Description
otEx4963 [lsy-6p(fosmid delta 150bp downstream)::GFP + ttx-3:mCherry]. Maintain otEx4963 by picking animals with mCherry in the AIY neurons. otIs306 [hsp-16.2::che-1::3xHA + rol-6(su1006)]. Rollers.
OS2017 C. elegans hsf-1(sy441) I; nsEx1129. Show Description
nsEx1129 [osm-6p::hsf-1 + hsp-16-2::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP expression in amphids and phasmids following heat shock; some background expression in pharyngeal muscle cells. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
OS2723 C. elegans hsf-1(sy441) I; che-2(e1033) X; nsEx1552. Show Description
nsEx1552 [sra-6p::hsf-1 + hsp-16-2::che-2 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
OS2728 C. elegans hsf-1(sy441) I; che-2(e1033) X; nsEx1555. Show Description
nsEx1555 [osm-6p::hsf-1 + hsp-16-2::che-2 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
OS3062 C. elegans hsf-1(sy441) I; nsEx1730. Show Description
nsEx1730 [myo-2p::hsf-1 + hsp-16.2::GFP + hsp-16.41::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Pharyngeal GFP expression following heat-shock. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
PC71 C. elegans ubIs4. Show Description
ubIs4 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn4.
PC72 C. elegans ubIs5. Show Description
ubIs5 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48 and hsp16-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn5.
PC73 C. elegans ubIs6. Show Description
ubIs6 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains a translational fusion to lacZ in which a Sau 3A fragment containing the intergenic region of a hsp16-48 and hsp16-1 gene pair of locus hsp16A was fused in-frame to lacZ to the Sau 3A site in exon of hsp16-1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn6.
PHX1364 C. elegans hsp-12.6(syb1364[hsp-12.6::mKate2]) IV. Show Description
mKate2 tag was inserted into the endogenous hsp-12.6 locus using CRISPR/Cas9. HSP-12.6::mKate2 expression most visible in the muscles. Reference: Koutsoumparis A, et al. Curr Biol. 2022 Apr 26;S0960-9822(22)00581-4. doi: 10.1016/j.cub.2022.04.012. PMID: 35504281
PS1427 C. elegans syIs6. Show Description
syIs6 [hsp-16.41p::lin-3]. Chromosomal insertion of the extrachromosomal array syEx23. Do not distribute this strain; other labs should request it from the CGC.
PS2442 C. elegans dpy-20(e1282) IV; syIs44 V. Show Description
syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Non-Dpy. Upon heat shock, two intense spots of nuclear fluorescence due to lacO in the chromosome, and a diffuse nuclear fluorescence due to nuclear-localized GFP-lacI. Array derived from Fire Lab vector pPD49-78 and dpy-20 rescuing construct pMH86. Do not distribute this strain; other labs should request it from the CGC.
PS2958 C. elegans syIs46 II; ncl-1(e1865) III; dpy-20(e1282) IV; him-5(e1490) V. Show Description
syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC.
PS7055 C. elegans syTi1 X. Show Description
syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).
PS7058 C. elegans syTi2 II. Show Description
syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).
PS7169 C. elegans syIs337 syIs398 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7171 C. elegans syIs337 III; syIs400 V. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III.  syIs400 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)] V. syIs337 is a GFP cGAL effector. syIs400 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7172 C. elegans syIs337 syIs401 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs401 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs401 is hsp-16.41 cGAL driver for heat shock promoter. Low levels of GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PX631 C. elegans fxSi3 I; fxSi4 II; fog-2(q71) V. Show Description
fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605