| MT18144 |
C. elegans |
nIs287 X. Show Description
nIs287 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
|
|
| MT18145 |
C. elegans |
nIs289 X. Show Description
nIs289 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
|
|
| MT18690 |
C. elegans |
sfa-1(n5223) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.
|
|
| MT19075 |
C. elegans |
nIs352. Show Description
nIs352 [eya-1p::GFP::eya-1 + rol-6(su1006)]. Rollers. Rescuing array was integrated in eya-1(tm759) background. Reference: Hirose T, Galvin BD, Horvitz HR. Proc Natl Acad Sci U S A. 2010 Aug 31;107(35):15479-84.
|
|
| MT19085 |
C. elegans |
hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
|
|
| MT19110 |
C. elegans |
nIs363 X. Show Description
nIs363 [D2096.6 (1.7kb UP)::pes-10::4xNLS::GFP + lin-15AB(+)]. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27 [NOTE (Aug 2019): the nIs363 trasngene in this strain was previously described as nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X.]
|
|
| MT19372 |
C. elegans |
sptf-3(n4850) I; nIs283 X. Show Description
nIs283 [gcy-10p::4xNLS::GFP + lin-15(+)]. gcy-10p::4xNLS::GFP is expressed in I1 neurons. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358.
|
|
| MT19454 |
C. elegans |
nIs396 V. Show Description
nIs396 [sams-5 3'::4xNLS-GFP + lin-15(+)] V. GFP expression in MI. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27
|
|
| MT19635 |
C. elegans |
lin-15B&lin-15A(n765) X; nIs407. Show Description
nIs407 [hlh-2::GFP + lin-15(+)]. Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
|
|
| MT19703 |
C. elegans |
nIs394 III; lin-15B&lin-15A(n765) X. Show Description
nIs394 [ngn-1::GFP + lin-15(+)] III. Translational GFP reporter. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27.
|
|
| MT19756 |
C. elegans |
nIs408 I. Show Description
nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62.
|
|
| MT19851 |
C. elegans |
sptf-3(tm607)/hIn1 [unc-101(sy241)] nIs425 I; nIs175 IV. Show Description
nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
|
|
| MT19859 |
C. elegans |
nIs431 X. Show Description
nIs431 [GFP::sptf-3] X. GFP::SPTF-3 is ubiquitously expressed. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
|
|
| MT20109 |
C. elegans |
dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Heterozygotes are WT GFP+. Segregates GFP+ Dpy Sterile and non-GFP Dpy Unc. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.
|
|
| MT20110 |
C. elegans |
unc-4(e120) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. Show Description
nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
|
|
| MT20111 |
C. elegans |
unc-4(e120) bli-1(e769)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. Show Description
nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Bli; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
|
|
| MT20112 |
C. elegans |
+/eT1 III; unc-46(e177) dpy-11(e224)/eT1 nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
|
|
| MT20113 |
C. elegans |
unc-32(e189) dpy-18(e499)/eT1 III; +/eT1 nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
|
|
| MT20114 |
C. elegans |
eT1 (III;V); nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Unc.
|
|
| MT20187 |
C. elegans |
rba-1(n5418) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ and segregate WT green-glowing heterozygotes and non-glowing rba-1 homozygotes. rba-1(n5418) homozygotes are sterile or produce eggs that fail to hatch. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Nakano S, Stillman B, Horvitz HR. Cell. 2011 December 23; 147(7): 1525-1536.
|
|
| MT20298 |
C. elegans |
nIs408 I; nIs454 II. Show Description
nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. nIs454 [mab-10p::mab-10::GFP + ttx-3p::GFP] II. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62.
|
|
| MT20434 |
C. elegans |
chaf-1(n5453) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.
|
|
| MT20492 |
C. elegans |
lin-15B&lin-15A(n765) X; nIs471. Show Description
nIs471 [lgc-55::GFP + lin-15(+)]. GFP expression in GLR glia-like cells and head muscles. Reference: Ringstad N, et al. Science. 2009 Jul 3;325(5936):96-100.
|
|
| MT21394 |
C. elegans |
nIs540 X. Show Description
nIs540 [pig-1p::GFP + rol-6(su1006)] X. Rollers. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
|
|
| MT21478 |
C. elegans |
set-17(n5017) II ; unc-119(ed3) III ; nSi3 IV Show Description
nSi3 [set-17p::set-17(+)::GFP::set-17 3UTR + unc-119(+)] IV. nSi3 expresses a translational fusion of genomic set-17 and GFP. nSi3 rescues the brood size defect of n5017 in this strain. nSi3 is a single copy MOS-mediated transposition into the cxTi10882 site; GFP detectable in the nuclei of the hypoderm, sperm and proximal germline, as well as some other cells. Reference: Engert CG, et al. PLoS Genet. 2018 Apr 27;14(4):e1007295.
|
|
| MT21910 |
C elegans |
lin-15AB(n765) X; nEx2065. Show Description
nEx2065 [gur-3p::GFP + lin-15(+)]. Maintain by picking non-Muv. GFP expression in I2, I4, AVD and PVC. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. PMID: 25640076.
|
|
| MT23160 |
C elegans |
lin-15AB(n765) X; nIs534; nEx2314. Show Description
nIs534 [odr-1p::GCaMP3 + lin-15(+)]. nEx2314 [odr-1p::gur-3 + ges-1p::GFP]. Pick animals with GFP expression in gut to maintain. odr-1p::gur-3 expression in AWC and AWB causes them to respond to light exposure. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. doi: 10.1016/j.neuron.2014.12.061. PMID: 25640076.
|
|
| MT23162 |
C elegans |
kyIs511 V; nEx2316. Show Description
kyIs511 [gcy-36p::GCaMP + unc-122p::GFP]. nEx2316 [gcy-36p::gur-3 + ges-1p::GFP]. Pick animals with GFP expression in gut to maintain. Expression of gcy-36p::gur-3 causes URX to respond to light 30% of the time. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. doi: 10.1016/j.neuron.2014.12.061. PMID: 25640076.
|
|
| MT8457 |
C. elegans |
lin-15B&lin-15A(n765) X; nIs60. Show Description
nIs60 [vab-3::GFP + lin-15(+)]. Animals are non-Muv.
|
|
| MT8603 |
C. elegans |
nIs70. Show Description
nIs70 [(pGS39) ced-8::GFP + rol-6(su1006)]. Rollers. Reference: Stanfield GM & Horvitz HR., Mol Cell. 2000 Mar;5(3):423-33.
|
|
| MT9343 |
C. elegans |
lin-36(n766) III; lin-15A(n767) X; nIs93. Show Description
nIs93 [(pJHT27)lin-36p::GFP::lin-36 (full-length coding) + rol-6(su1006)]. Rollers. Non-Muv -- nearly completely penetrant rescue of Lin-36. Reference: Thomas & Horvitz (1999) Development 126(15):3449-59.
|
|
| MT9971 |
C. elegans |
nIs107 III. Show Description
nIs107 [tbh-1::GFP + lin-15(+)] III. GFP expression in RIC. Reference: Alkema MJ, et al. Neuron. 2005 Apr 21;46(2):247-60.
|
|
| MU1085 |
C. elegans |
bwIs2. Show Description
bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped.
|
|
| MU1147 |
C. elegans |
bwIs4. Show Description
bwIs4 [fax-1::GFP + rol-6(su1006)]. Rollers. GFP reporter with expression in various neurons and DTC.
|
|
| MU1255 |
C. elegans |
nhr-67(tm2217) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2217 homozygotes (arrested L1 larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| MU1268 |
C. elegans |
bwIs6. Show Description
bwIs6 [nhr-67::GFP + rol-6(su1006)]. Rollers.
|
|
| MU1269 |
C. elegans |
nhr-67(pf88) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Pick GFP+ to maintain -- viable pf88 homozygotes (Pvl Egl) can overtake the balanced population. nT1[qIs51] is homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Reference: Verghese E, et al. Dev Biol. 2011 Aug 15;356(2):516-28.
|
|
| NB131 |
C. elegans |
wrn-1(gk99)/mIn1[dpy-10(e128) mIs14(GFP)] II; exo-1(tm1842) III. Show Description
Heterozygotes (wrn-1/mIn1;exo-1) are WT and GFP+. mIn1 homozygotes (mIn1;exo-1) are Dpy and GFP+. wrn-1;exo-1 homozygotes are non-GFP. Reference: Ryu, J.S. and Koo, H.S. (2017). FEBS Lett.
|
|
| NB320 |
C. elegans |
dna-2(jh115)/mIn1[dpy-10(e128) mIs14(GFP)] II. Show Description
Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. dna-2 homozygotes are non-GFP. Reference: Lee, K.H., Lee, M.H., Lee, T.H., Han, J.W., Park, Y.J., Ahnn, J., Seo, Y.S. and Koo, H.S. (2003). Mol Cell 15, 81-6.
|
|
| NB327 |
C. elegans |
ints-6(tm1615) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploids, and non-GFP dic-1 homozygotes. dic-1(tm1615) homozygotes arrest at the L3 larval stage. ints-6 previously known as dic-1.
|
|
| NC1013 |
C. elegans |
unc-119(ed3) III; wdEx455. Show Description
wdEx455 [acr-14::GFP + unc-119(+)]. Pick non-Unc to maintain.
|
|
| NC1015 |
C. elegans |
unc-119(ed3) III; wdEx457. Show Description
wdEx457 [F39B2.8::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in pharyngeal muscles, posterior ventral cord motor neurons, tail neurons, and a few head neurons. Construct made by M. Vidal lab; candidate unc-37 target gene. F39B2.8 also known as gpr-158.
|
|
| NC138 |
C. elegans |
dpy-20(e1282) IV; wdIs3 X. Show Description
wdIs3[del-1::GFP + dpy-20(+)]. del-1 is expressed in the VB motor neurons beginning the the L2 larval stage. By the end of L2, del-1::GFP is also visible in a few VA motor neurons at the anterior end of the nerve cord. Expression of del-1::GFP in the VAs progresses in a wave from anterior to posterior, with all VAs expressing del-1::GFP by the adult stage. Thus, del-1::GFP is not expressed in the VAs during the L2 period in which unc-4 functions in those cells to establish synaptic inputs but is expressed in the VAs after they have been wired into the ventral cord circuit. del-1::GFP is also expressed in five neurons (VB1, VB2, SABVR, SABVL, VA1) in the retrovesicular ganglion at the anterior end of the ventral nerve cord. During the mid-L2 larval stage, del-1::GFP expression in the ventral nerve cord is largely restricted to the VB class of motor neurons.
|
|
| NC1469 |
C. elegans |
unc-119(ed3) III; wdEx575. Show Description
wdEx575 [ZC155.2::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expressed in cholinergic motor neurons, head & tail , neurons, and excretory cell. Construct made by Marc Vidal's group at Harvard as part of the promoterome project.
|
|
| NC1528 |
C. elegans |
unc-119(ed3) III; wdEx595. Show Description
wdEx595 [F08G12.1::GFP + unc-119(+)]. Pick non-Unc to maintain. Construct made by Marc Vidal's group at Harvard as part of the promoterome project.
|
|
| NC1624 |
C. elegans |
unc-119(ed3) wdIs62 III. Show Description
wdIs62 contains [ceh-12::GFP + unc-119(+)]. Superficially wild-type.
|
|
| NC168 |
C. elegans |
unc-4(e26) II; dpy-20 IV; wdEx60. Show Description
wdEx60 contains [acr-5::GFP + dpy-20(+)]. Maintain by picking non-Dpy.
|
|
| NC1686 |
C. elegans |
wdIs51. Show Description
wdIs51 [F49H12.4::GFP + unc-119(+)]; likely integrated in X. GFP expression in PVD.
|
|
| NC1687 |
C. elegans |
wdIs52. Show Description
wdIs52 [F49H12.4::GFP + unc-119(+)].
|
|
| NC1730 |
C. elegans |
unc-5(e152) IV; wdIs52. Show Description
wdIs52 [F49H12.4::GFP + unc-119(+)]. PVD defects in primary branch guidance, number of secondary branches, and tertiary branches are longer than wild-type.
|
|