Search Strains

Y53C10A.12. Replaces strain VC358. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok600 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAACAACAAATCCTCGGCT. External right primer: GCTCAATGCGTCAACAACAT. Internal left primer: GTGGATGAGGTGGAAGTCGT. Internal right primer: GTCGCGAAACGGTAATCAAT. Internal WT amplicon: 2605 bp. Deletion size: 877 bp. Deletion left flank: ATGAGTCAATGGACCGGATCCCATGTACAT. Deletion right flank: TTCTAAGAAATTTTTATTTTCTGAAAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G10A.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3088 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAATTGTTCGGCGAATTTT. External right primer: AAACATTTTCAACCCTGCAAGT. Internal left primer: ATACGTCACCCGAGCAATTC. Internal right primer: CAACCAGAATGCAGAGCAAA. Internal WT amplicon: 1226 bp. Deletion size: 763 bp. Deletion left flank: CCAGTATAGATTGAATAACTTTAAAAATTT. Deletion right flank: AAAATGCTCCACGTACGCATTCTCATGATT. Insertion Sequence: AACTATAGTTATTTAAATTCTTACTGTAGTTTTCGCTAAGTGATATCGCGCGTCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01A2.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TAAATATAATACCGTGCGTGCG. External right primer: TCAAAGTCATGTTTCCGTATCG. Internal left primer: GGCTCAGGGTAAATAGACATGG. Internal right primer: TTTAAATGGGTTTGAATCTGGG. Internal WT amplicon: 1458 bp. Deletion size: 510 bp. Deletion left flank: ATTGCAAAAGTGGGCGGGGCGTCGTTTCGT. Deletion right flank: ATCAACTCGATTTTGAGCAAAACTATCTCG. Insertion Sequence: TAGTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W08E3.1. Heterozygotes are WT and segregate WT, Unc hIn1 homozygotes and gk209 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Recessive lethal deletion balanced by hIn1. Deletion of 4986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAATTTCGGATTCGGGTTCCATGCCA; Right flanking sequence: GTCTGAAAATTGAAAATAAATTTAAAAACT. See WormBase Variation gk5013 for details.

Apparent homozygous lethal or sterile deletion balanced by hIn1[unc-101]. Pick viable fertile GFP+ animals to maintain; hIn1 homozygotes are non-GFP Unc. Deletion of 3831 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAAGTCGAATTTTTAGCCAAAAACCTTAG. Right flanking sequence: GCCGCTCAAATTGCGTATAAAAGGACGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5041 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2264 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCTTTGAAATGACGGATTTTTGGACCACAT. Right flanking sequence: CCCGGCTTCTCCTTACAATGCCTGCAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 7590 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ACGTTTCCGAGTCACTTTGCTCAAACACCC. Right flanking sequence: AGGAAGTGTAGAAATATTGAATGATGATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

C49A1.4. Deletion balanced by unc-101-marked inversion. Heterozygotes are WT and segregate WT, Unc-101 hIn1 homozygotes, and ok654 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18A11.7. Suppressed Unc. Left primer: TCCACCAACAAGCTTTTGCC. Right primer: CTCAGTCGATCACAATACAG. WT amplicon: 1031 bp. Deletion size: 133 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53F10.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1246 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

gfEx1 [hmt-1p::GFP + unc-119(+)]. Maintain under normal conditions. GFP expression detected in Intestinal cells, terminal pharyngeal bulb, coelomocytes, and head & tail neurons. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. Hypersensitive to cadmium. Lacks coelomocytes and accumulates GFP in pseudocoelome. Maintain under normal conditions. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.

rhIs13 [unc-119::GFP + dpy-20(+)]. RNAi hypersensitive, effective RNAi in the nervous system. unc-119::GFP in neurons is almost completely suppressed on anti-GFP RNAi plates. Reduced progeny at 25C (almost sterile). nre-1(hd20) and lin-15B(hd126) seem very closely linked. Maintain at 15C or 20C.

hdIs17 [glr-1::YFP + unc-47::YFP + unc-129::YFP + rol-6(su1006)]. hdIs10 [unc-129::CFP + glr-1::YFP + unc-47::DsRed + hsp-16::rol-6(su1006)]. Rollers. Reduced progeny at 25C (almost sterile). RNAi hypersensitive, effective RNAi in the nervous system. unc-47::DsRed is weak and only visible in adults. hsp-16::rol-6 transgene is not effectively Roll. Maintain at 15 or 20C.

Maintain by picking viable fertile wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced with hln1. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ homozygotes, and Unc homozygotes. Derived from parental strains VH7178 and PS1056. hd7179 is a deletion of 12118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGGCGAGGTAACGGGCGAATATTGCCG; Right flanking sequence: AACTGATTCTCAGTTAACCTAACCAATGAT. sgRNA #1: CAAACCCCGTACTTTTCAGG; sgRNA #2: AAGAAGTCGGGCTACTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile GFP+ and Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III+. Apparent homozygous lethal or sterile deletion stabilized over oxTi731. Heterozygotes are wild-type GFP+ and tdTomato+ and segregate wild-type hereozygotes (GFP+ tdTomato+), hd7198 homozygotes (GFP+), oxTi731 homozygotes (tdTomato+), and occasional hd7198 oxTi731 recombinants. Derived from parental strains VH7198 and EG7887. hd7198 is a deletion of 1473 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACCCGCCAAATTCATCAAACAATTCCCG; Right flanking sequence: CGGCGACTACATTGATACTACGAGAAATTG. sgRNA #1: CATAAAAACCGAGGAGCCGG; sgRNA #2: CGAAACTACGAGGCTCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

pmcIs1 [ant-1.1p::ant-1.1::GFP + unc-119(+)]. Expression of ant-1.1::GFP under ant-1.1 promotor (Farina et al., Dev Dyn 2008) in most tissues including the gonads and in the spermatozoa. GFP intensity is low and unstable. GFP positive worms should be selected under fluorescence microscope. ant-1.1::GFP expression seems to be more stable when worms are grown at 24°C and in the dark. Reference: Al Rawi S, et al. Science. 2011 Nov 25;334(6059):1144-7.

wwEx34 contains [hlh-31::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

wwEx41 [hlh-13::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx42 [hlh-15::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx43 [hlh-27::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx23 [mir-270p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx20 [mir-245p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx26 [mir-42-44p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx44 [hlh-33::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx35 [hlh-16::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs3 [mir-236::GFP + unc-119(+)]. Wild-type.

wwEx28 [mir-72p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx18 [mir-227-80p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx52 [nhr-86p::GFP + unc-119(+)]. Maintain by picking superficially wild-type GFP+ worms. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.

wwEx36 [hlh-19::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx45 [unc-3::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs6 [mir-255p::GFP + unc-119(+)]. Wild type.

wwIs4 [mir-238p::GFP + unc-119(+)]. Wild type.

wwEx46 [lin-22::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx19 [mir-230p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx30 [mir-57p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx47 [hlh-30::GFP + unc-119(+)]. Pick wild-type. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs5 [mir-240-786p::GFP + unc-119(+)]. Wild type.

wwEx29 [mir-83p::GFP + unc-119(+)]. Maintain by picking WT.

wwEx31 [mir-268p::GFP + unc-119(+)]. Maintain by picking WT.

wwEx37 [ngn-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs15 [mir-63p::GFP + unc-119(+)]. Wild-type.

wwIs18 [mir-79p::GFP + unc-119(+)]. Wild type.

wwIs8 [mir-35-41p::GFP + unc-119(+)]. Wild-type.

wwEx24 [mir-355p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx25 [mir-359p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwIs1[mdl-1::GFP + unc-119(+)]. Worms are non-Unc.

wwEx32 [mir-61-250p::GFP + unc-119(+)]. Maintain by picking WT.