Search Strains

Reference: Iwasa H, et al. Aging Cell. 2010 Aug;9(4):490-505.

Enhanced pathogen susceptibility. Egg laying in response to food is defective. Reference: Shivers RP et al., (2009) Cell Host Microbe 6:321-30.

Y37E3.10. qd338 disrupts Ser49 phosphorylation site; suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.

ZK1098.4. qd335 suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.

Pathogen avoidance phenotype. Defective nose touch response.

Homozygotes are viable and do not show any gross abnormalities. Grows normally at all temperatures. Deletion removes 1505 bp including the first 4 exons.

Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.32°N, 103.82°E) on 7/19/2006.

Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.45°N, 103.72°E) on 7/19/2007.

Homozygous viable with neuronal defects.

Published in Zhang et al PLoS ONE 4: e6348 (2009).

hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323.

hpIs171 [acr-2p::D3cpv + lin-15(+)]. Strong fluorescent marker for motor neuron Ca2+ imaging (FRET). Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460

hpIs193 [nlf-1p::nlf-1::GFP + lin-15(+)]. GFP expression in head and tail neurons, as well as along ventral cord. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043

hpIs179 [sra-11p::D3cpv]. 2.8 kb sra-11 promoter sequence drives Cameleon (a genetically-induced calcium indicator) in AVB, AIA, and AIY head interneurons. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.

Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).

hpIs321 [nmr-1p::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neurons ablation (AVA/AVE/AVD/others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035

hpIs331 [lgc55Bp::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neuron ablation (AVB & others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035

648 bp deletion (confirmed). About 80% of animals show defects in vulval development (Muv or Vul).

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.

zwEx101 [inx-1p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx102 [inx-2p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx103 [inx-3p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx104 [inx-4p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx105 [inx-5p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx106 [inx-6p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx107 [inx-7p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx108 [inx-8p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx109 [inx-9p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx110 [inx-10p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx111 [inx-11p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx112 [inx-12p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx113 [inx-13p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx114 [inx-14p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx115 [inx-15p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx116 [inx-16p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx117 [inx-17p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx118 [inx-18p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx119 [inx-19p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx120 [inx-20p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx121 [inx-21p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx122 [inx-22p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zwEx123 [eat-5p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

zxEx22 [myo-3p::ChR2(H134R)::YFP + lin-15(+)].

zxEx32 [myo-3p::NpHR + myo-3p::ChR2(H134R)::YFP + lin-15(+)].

Levamisole resistant. Twitcher.

Levamisole resistant twitcher. Weakly semi-dominant. M-MATING++ 1-10%WT.

Pseudowild levamisole resistance. Head more resistant than body. Body resistance is temperature sensitive. WT phenotype.

Pseudo wild type levamisole resistance. WT phenotype.

Pseudo wild type levamisole resistant. WT phenotype. pka lev-10.