C25D7.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

bqSi142 [emr-1p::emr-1::mCherry + unc-119(+)] II. Might contain unc-119(ed3) in the background. Single-copy emr-1::mCherry transgene under control of emr-1 regulatory sequences. emr-1(gk119) embryos arrest when lem-2 is depleted by RNAi; bqSi142 fully rescues this phenotype. Reference: Morales-Martínez A, Dobrzynska A, Askjaer P. J Cell Sci. 2015 Feb 4.

Improved survival at 37C. Dauer constitutive and longer lifespan at 28C. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151

Improvement in thermotolerance at 37C, though weaker than in null mutants. Longer lifespan than to tax-2(gk117937) null mutant. Higher frequency of dauer formation and survival at 28C than tax-2(gk117937) null mutant. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151

Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.

Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile rec-8(ok978); coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in M01D1.2 (gk1188), identified by CGH (Comparative Genome Hybridization). Minimum deletion size: 345 bp; maximum size 5952 bp. Left flanking probe: TGAAATCGGTGAGCTTTTGGTCTGGGTAAGCTCTCAGGAGGAGCCAGCCT. Right flanking probe: CTATTCAACCCCCATGCGTTGGATGAAGCCTTCCCAATGTCCAACCTTTA. Left deleted probe: AAGCCCTGCGATCACTGGTAAGCTCCTGATCACCCTATTACTTGCACAGT. Right deleted probe: AATCGCAGAGATTGTCAGCGACTTGAAGCTCGGCGGATTGGACAGGCCGT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

R11G1.6. External left primer: GAGACGTTGAAGTACGCGCT. External right primer: CCGAAAATTCGAAAGCGTAA. Internal left primer: TTACCCAGAGACCGAACTGC. Internal right primer: CTTCATCGCCCTCTTTCCTT. Internal WT amplicon: 838 bp. Deletion size: approximately 200 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: AAAGGATCACCCACAGCATCTCTCCAAACAGCCAACCCAAAACTAAAATT. Left deleted probe: AAAACAATGAGTACGGATTCAAAAATAAAACCTTGTAGGAAACTTGTGTA. Right deleted probe: GGATTCGATGGCATCTGTATAGAGTTGAATGGCATAATTATAGGCATTTA. Right flanking probe: GAAGCGATTCGAATCGTTCTCCCGACAACATCTTAGGAACAACGGCCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in B0310.1 (gk1191), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: GAATCCGAGAAAAGCGTCTG. External right primer: GATCTTTTGGCCTTTTGCTG. Internal left primer: TCATCCACGTAGACTTGCCA. Internal right primer: TTGCAATCCTGAAGCAAATG. Internal WT amplicon: 2706 bp. Maximum deletion size: 1911 bp. Minimum deletion size: 881 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: CAAAACGCGTGTTAACCCTGTGCCATCTGTCTGATCCGACTCAGAAAACA. Left deleted CGH probe: TTTCTGAATACAAGAGAAGAGCATAATGGGCGCTGATCTTCCACCGAAAT. Right deleted CGH probe: AATACATTTAAGCTACACACCTACTTGCCTGCTCTCAGTGTGACCGAAAA. Right flanking CGH probe: AAGTTTATGGGCCTGAAACAATTGTATTTTCGTATCTTGACATTGATAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F19C6.1 (gk1192), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: CGAACTCGCCGTTCTACTTC. External right primer: GTTTTAGCGGCTTCAACTGC. Internal left primer: CGTCCCTTGATTGGTTCATT. Internal right primer: GATTCTCATTGGCAGACGGT. Internal WT amplicon: 3924 bp. Approximate deletion size: 2575 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: TTCGTTCAAGCTTAATGTTTCAGCATGCCTCTTCTTGACTCGCTTCTTTT. Left deleted CGH probe: TCCGGTACCAATTGTCGACTTGCTACCATTTTACGACCGCACAACTAAAA. Right deleted CGH probe: TAGTGAGGGAACTGTAGATAATTCTTCCACTTTTTGCTTTTTCCTTTCTT. Right flanking CGH probe: TACCGTATTGGCAACGATATTTTCAATCTCCATGGTCCTATCGTGGCTGA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

C16A11.6. External left primer: TCCACGGGAATTTCTACTGC. External right primer: CGCAAATTTTTCCGTGTTTT. Internal left primer: CTCCTTCAATCCAGCTTTCG. Internal right primer: AGACAATTCCGCCAACAATC. Internal WT amplicon: 3801 bp. Approximate deletion size: 1600 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: CGATAAATCGTTCGATTAGGGGGTTATCCGATGACCGAGTCATGAAATGT. Left deleted probe: CATAAACCGCCAAGGTTCGTGAATCCTGTGCGACGCCAACTTAAATTAGT. Right deleted probe: TGAAATTTCGAACCTTGAACTTCTTAAATGACTGGGGCAGCTCAAGAATA. Right flanking probe: AAAATGCGTGCGGCGCGTTGCAACTTAGCTCCGCCCACCCTTTGAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F42A10.1 (gk1194), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: TGGCTTTGCAATCTGTTGAG. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: ACTTGATTCTTGACGAGCCT. Internal right primer: CAACTGATAAGAGTGGTTCGCA. Internal WT amplicon: 906 bp. Maximum deletion size: 137 bp. Minimum deletion size: 101 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking probe: TTTTGTTTCGCATTCGGTTGTTTCCCATATTTCACCCAGTTTCCACGTTT. Left deleted probe: TATTAAATTGTTCACTTCAAAATTTAAGTATGAGTGAGAGCTCTAGCCTG. Right deleted probe: AAATAATGCAAAGGTCTTCCTTGCTCGGGTCATCATGAAGAAGATACTCG. Right flanking probe: GGGTCATCATGAAGAAGATACTCGAGTTGGTAAGGCTTATCGTTCTGAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries homozygous deletions in C26C6.1 (gk1195) and F14D12.6 (gk1196), identified by CGH (Comparative Genome Hybridization), and confirmed by PCR but not sequenced. The deletions can be detected by the following primers. gk1195: External left primer: ACGGAAGTTCTCAAAGCGAA. External right primer: TCGTCTTCAGCAGTGAATGG. Internal left primer: GCAGGCTCTTCAATGTACGA. Internal right primer: TCTCGGAAAGGCGTAAGAAA. Internal WT amplicon: 506 bp. Approximate deletion size: 100 bp. gk1196: External left primer: CCGGGAAATCACAGCACTAT. External right primer: TACGAATGCAGCGACAGAAC. Internal left primer: AGGATTCACGACGAATGTCC. Internal right primer: CTTCTCGGTAACTTCGCCAC. Internal WT amplicon: 1785 bp. Approximate deletion size: 900 bp. gk1195 left flanking probe: GATGAGGAGGGAGGAAACAAACCGGCGATGGTGAAAAGACATGTAGGATA. gk1195 left deleted probe: TTTCTGCATGTTATTAATTAAATTCTTTTCAGGAAAGCGAAGTCGAAATG. gk1195 right deleted probe: ATATGTGGCACCATGTTACGCATACGTTTCCCGATCTGACGAGAAGAAAA. gk1195 right flanking probe: ACGCATACGTTTCCCGATCTGACGAGAAGAAAACTCCTCTTCACATTTTC. gk1196 left flanking probe: AGCAACCGACATCTGGACGACACGTCGCCGTAGCTCCTTTTGAGTGACGT. gk1196 left deleted probe: GCTCAAATTGCAAACTAGTTTTCATTTGTAGAACTCCATGAGTGGATGAA. gk1196 right deleted probe: TCTCTGTTTCCTTCAGTCGCTGCCTACTATGACGGATGGTTATACTGTAG. gk1196 right flanking probe: CTATGACGGATGGTTATACTGTAGATTTTGGCATAAACGATGATGAGAAT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

D2089.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08H9.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34G6.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R13H4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59B2.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC190.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18C5.2. Homozygous lethal deletion chromosome linked to dpy-10 mutation, balanced by GFP- and dpy-10-marked inversion. Heterozygotes are Dpy with relatively dim GFP expression in pharynx, and segregates Dpy dim GFP, Dpy bright GFP (mIn1 homozygotes) and gk116 homozygotes (embryonic/early larval arrest). Nature of dpy-10 lesion unknown; recessive lethality could be the result of this mutation. Pick Dpy dim GFP+ and check for correct segregation of progeny to maintain." Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1197) in Y47D3B, detectable by PCR using the following primers. External left primer: AAACGCGAAAATGTCGAAAC. External right primer: GATGTCTTCTCCCCCTCCTC. Internal left primer: GCGTCAAATATGTCGCGTAA. Internal right primer: TTAGTAGGCGGCTTTGTGGT. Internal WT amplicon: 1949 bp. Deletion size: 233 bp. Deletion left flank: ACCCCTGGACGTTTGGGCGCGTTTTTGTCA. Deletion right flank: TTTTCAGATAGTACACACACACATAGGAAA. Validation: No CGH probes for gk1197. Other deletions (gkDf42, gkDf43) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). [NOTE (02/11/13): The presence of gk118907 has been confirmed in this strain.] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

K12H6.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54G8.2. Superficially wild type; at low penetrance bursts at vulva. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59D12.1. Identified by PCR, validated by CGH. External left primer: CTCACAAAAAGGGGCGAATA. External right primer: TACCCCTTACACTAACGGCG. Internal left primer: GGTTGTGTTCTATCCCGACG. Internal right primer: ATGAGTGCTTGGGACTTTGG. Internal WT amplicon: 937 bp. Deletion size: 585 bp. Deletion left flank: ACTAGGTTTTCTGTTTGTCACATTTTTCTT. Deletion right flank: CTTATTTGAATATAAACATTCAAGATTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 384 bp. Deletion left flank: CTATTCAAGAGAAACTCTAGAGGATCGCTT. Deletion right flank: AGTTTAAGAAAAATAAAGTAAAAGAAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16B12.6. Identified by PCR, validated by CGH. External left primer: CGATCACCAACAAACAATGC. External right primer: TACGTGACCCGTTGACAAAA. Internal left primer: CAGTTTAGAAATGCCTCGCC. Internal right primer: CGGACCGTCGTAAACAAACT. Internal WT amplicon: 2674 bp. Deletion size: 2358 bp. Deletion left flank: ATTGTGAAAACAAAAAAAAACAGATGAAGC. Deletion right flank: GCAATTCTTCAATCATTTCAGGTTTTCTAT. Insertion Sequence: AGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1. Identified by PCR, validated by CGH. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 265 bp. Deletion left flank: TACGCACCTTTTGTGTCCCTTCAGGCGTGA. Deletion right flank: AGAAAAATAAAGTAAAAGAAACTGGAAAAT. Insertion Sequence: ATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1120) in Y52B11A.9, detectable by PCR using the following primers. External left primer: CAATCCCCTCTCTCATCCAA. External right primer: TATTTGCAACGACACTCCGA. Internal left primer: TGCATATGACGCTCTTCGTC. Internal right primer: TTCCAGCTTCTGCCAAATGT. Internal WT amplicon: 1563 bp. Deletion size: 405 bp. Deletion left flank: GGAGCTTTTCGGCTCAAATTATTGGAATAT. Deletion right flank: ACAAACTACAAAATTTCTAGCCTCTACCAA. Validation: gk1120 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 571 bp. Deletion left flank: AAAAAGGAAAACGGTGTTTTCTACTACCAC. Deletion right flank: GTGAGTGCTGGAGGAGGTTGTTTTTCGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37F4.6. External left primer: CAGAAGTTTGTGGGTTCGGT. External right primer: ACCTGCCTACGTGCCTAGAA. Internal left primer: ACTCCATATCTCCGCAGGAA. Internal right primer: TCCTGGTCCATCTTCGAGTT. Internal WT amplicon: 2083 bp. Deletion size: 990 bp. Deletion left flank: TGAACACTTTTTTGTAAAAAATTTGGTTGC. Deletion right flank: CACGAGGGGCGTGGCCAACGACAATGATTG. Insertion Sequence: CGAGTTGGAACCAATTGATTTGAGCTTCATTATTTTTGAATATTCTAAATAGTTAAAGG TCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1, B0462.4. The allele gk1133 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 337 bp. Deletion left flank: TTTTTTTCAGATATTTAGGTTAGTCCACTT. Deletion right flank: GGGCACGCCCACTTTATACTATTTTGATGT. Insertion Sequence: TAT. The allele gk3031 was identified by CGH and not confirmed by PCR. Left flanking probe: TTATAAACAGAGACAAATTTAGACCAAAACTCTGTAGGAAAGTGAGTTTT. Right flanking probe: ACAGGAATATGAATTGAGTGATTGCTTGTGGTAGACTCTGTAGATGGTCT. Left deleted probe: AAGTGAGTTTTTCCGTGTGTTCTGTGGGATCAGGTGCTCCAAATCTTCCA. Right deleted probe: GCGCCAATGCTAATATTATACTTATATAAAAGCACTTAACAAGCTGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10B10.3, T08G11.2, Y63F8A.8. The gk1127 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 1379 bp. Deletion left flank: CCGGTTTTTCTACCGCCATATGTCCCCTCC. Deletion right flank: GGTTGAGTTGCTTGTTGGCATGAACAACTT. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1178) in F11E6.8, detectable by PCR using the following primers. External left primer: ACATATTCGACAAGGCACCC. External right primer: CACCCTTCGAGTCTACCCAG. Internal left primer: GCGAGTGAAAGGATCTGGAG. Internal right primer: TGGTGAGGGAATTGGAAAGA. Internal WT amplicon: 2406 bp. Deletion size: 1746 bp. Deletion left flank: ATTTTCCCATTTAGGTATACAAAACTTACA. Deletion right flank: GAGGCAAACTTCTCACTTCTTGAAACATTT. Validation: gk1178 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01D7.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.2. Identified by PCR, validated by CGH. External left primer: GCCGCAATTGTATTCTCCAT. External right primer: AATTCCCTGTTCACAGCGTC. Internal left primer: TATGTAGGGAATCGCGAAGG. Internal right primer: CTCTTGCTTCGAAACCCAAT. Internal WT amplicon: 2288 bp. Deletion size: 1832 bp. Deletion left flank: TCGATTTTTTCGGGAAATGTTGCGGAGCAC. Deletion right flank: ATTCTCAAAATTAGCTCTTTCAGTTCGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14A4.13. Identified by PCR, validated by CGH. External left primer: CACCTTTCCCCATGAAAATG. External right primer: GTCGCCAATGAGACGAATTT. Internal left primer: GCAGCAGTAGTGGCAGTGAA. Internal right primer: TTTCCCGAAGAAGAACGATG. Internal WT amplicon: 2574 bp. Deletion size: 1569 bp. Deletion left flank: CGATTCGCTTGCAAAGCTGAGCTCGCAATT. Deletion right flank: TACCAAAGTCCCACCTGCTCATTAGATTGA. Insertion Sequence: TCGGTTTAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C40A11.7, C40A11.8, C40A11.1, F56E10.1, Y38C9A.1, C50C10.2, F21H7.9. The allele gk1184 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: AATCACTTTCGGTGCAGCTT. External right primer: GTATGCCCCACAGTTTTGCT. Internal left primer: AGTATCGCGGCATTGTTAGC. Internal right primer: TGCTCAAGCTTGGAGAGACA. Internal WT amplicon: 2419 bp. Deletion size: 2042 bp. Deletion left flank: ACCGCAATTAATTCCAATTCTAAGGTTTAT. Deletion right flank: ACTGGCGTCTTACAGTAAATTTTGTGTGAC. The allele gkDf17 was identified by CGH but not confirmed by PCR. Left flanking probe: ATTCCGCGATGTCTCCTTAAATCTTTTGGCAGAGGTTCTCGATTATCCAT. Right flanking probe: ATTGATCGAAAGTTACGAAGACGTGGACTAGTCCCAAAATTCCTAGTGAC. Left deleted probe: GAAAATAGATTTCTACCACTGAACTGTTTTTCTTAACAAACTCATCGAAT. Right deleted probe: CTGTTGAGAACATATCTAGTATTAAGGAAGGAGGGAACTATTCCACAGGC. The allele gkDf18 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAATTTTCGAGGAAGATGAAGTTTATGCGGACGTCCAAAGTGTTGAAAA. Right flanking probe: GATTTCGCTGTGATAAGCGTCGAGGAGGCAATCGAAATGTGGAGCTTCTG. Left deleted probe: CCAAAGTGTTGAAAAACGGAAAATTCAGGATTTCGACGAGCGAATTGAGG. Right deleted probe: CAATTATGCAAATCTCGTCGATATTATACAAAATGATATAGATTTCGCTG. The allele gk3035 was identified by CGH but not confirmed by PCR. Left flanking probe: TGTTTCAGTATTGCCGTCTTATTATGTATAGATTTGCTATTCCATTTCTA. Right flanking probe: CATTTTCGAGTTCAATTTTCTGTGCAAACGCTGGAATGACAATATTCATG. Left deleted probe: TTTATCGTCCCATTAGCATTGTCACTTTTCAATGTTACTACAGTAGGATT. Right deleted probe: TTGTACGAAGGAGAGGAATATGCAAAGTTGAATGCTATTATTCATCTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01D4.6. Identified by PCR, validated by CGH. External left primer: CGCGTTGAAGTCAGTTGTGT. External right primer: GACTCCTGTTGGATTGGCAT. Internal left primer: CTGCCACATCAGTGTTGCTT. Internal right primer: CAAAGCCTCTCAGTGCGATT. Internal WT amplicon: 2450 bp. Deletion size: 774 bp. Deletion left flank: GAGCAAAGCGTAAAAAATGATTACATCTTT. Deletion right flank: TTTTACTTGACTCTCTGAAAGTCGAACAGA. Insertion Sequence: TTACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1130) in B0336.11, detectable by PCR using the following primers. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 416 bp. Deletion left flank: TAATAAACTTCATTGCGTCAAAGCTCTGAA. Deletion right flank: CATAATTGCATATGCAATATCTACATCGTA. Validation: gk1130 passed by CGH. Other deletion (gk3213) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C44C8.6. The gk1110 deletion allele in this strain was identified and isolated using PCR, and its breakpoints were determined by capillary sequencing of PCR products. Its presence was confirmed by the Vancouver Gene Knockout Lab by CGH (comparative genome hybridization). External left primer: ACTCTGTGCCACCAAAAACC. External right primer: CATATCCGTCCATTGTTCCC. Internal left primer: TGTCCTGCTTCAGTTTCCCT. Internal right primer: CATTGGTTGTCCGTGTTGAG. Internal WT amplicon: 1976 bp. Deletion size: 1024 bp. Deletion left flank: GAATTTTTAAATCAAAACTATTTGTTCCAA. Deletion right flank: GCGTATGACTAAGTCTATGCCTAAGCCTAA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25H8.6. Identified by PCR, validated by CGH. External left primer: CAGAGGCTCAGTTTCCGTTC. External right primer: GGTTTGGATGAAGGGGATTT. Internal left primer: TGCCAGACTTCAAACACTCG. Internal right primer: TGTGACCACGGACAGAAGAG. Internal WT amplicon: 2425 bp. Deletion size: 946 bp. Deletion left flank: GAAAATTGAAGATGATCATAAAATTCATAT. Deletion right flank: ACAAGACTGAATGGGAATTTGAGCCACCGC. Insertion Sequence: TGCCTTTGTTCGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26A1.4. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 174 bp. Deletion left flank: TTATGTTTATGTTTCAGTTCTGACACGCCA. Deletion right flank: TTAAAATATTTCAGATTGAATGTGGAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03F11.2. External left primer: TCTAGGTCAAAAGCGGAGGA. External right primer: CTTTAACACGGTGAAGGGGA. Internal left primer: GGAAATGGAGCATCGAGGTA. Internal right primer: CATATGCAAGATGTTTGCCG. Internal WT amplicon: 1241 bp. Deletion size: 655 bp. Deletion left flank: GCATTGAGCTTCTGCTAATGACATCGGCCA. Deletion right flank: TAAATTTTGAGAGTAAAGTTCTTACATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0336.11. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 425 bp. Deletion left flank: TTCTGCTTTTCGGTCCGCGACTTGATCTTC. Deletion right flank: AAGAGTAGAAACAGCCGGGGAGCGCTGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41G3. External left primer: CGTCACTCGACCAAGTAGCA. External right primer: ACTGCGAACGACGTAGTCAA. Internal left primer: GAAATCAAAGGCAGAAGGCA. Internal right primer: GTGCATAGTCAGGTGCATCG. Internal WT amplicon: 2071 bp. Deletion size: 274 bp. Deletion left flank: GTAAGATAAATAATCATGTTTATTTTCCGT. Deletion right flank: GCATTAGAAAATTTATATATTGTTTGCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E5A.5, T08B1.6. The allele gk1159 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TGAAGACGTTGAAGCAGGTG. External right primer: TGTTGACGATGACGGTGTTT. Internal left primer: GTGTTGTTGAAGCAGCTGGA. Internal right primer: GTGGAGACGAAGATCCCAAA. Internal WT amplicon: 2024 bp. Deletion size: 775 bp. Deletion left flank: GGGCTAAAAACGCAAAAACTGCAATTTCTA. Deletion right flank: AAAACAAACAATTTTTCAATATAATTTAAC. The allele gk3030 was identified by CGH but not confirmed by PCR. Left flanking probe: CAAAAGAATCAATCCACTAACAAATTGATTGGAATCGCTGGAATTCACTC. Right flanking probe: GCGGGTTTGACCTGACTACAGTACCACTTTATCATCAATCGAAATTGGAG. Left deleted probe: GGAATCGCTGGAATTCACTCGAGAAAATATATGCACACGATGCATGGAAT. Right deleted probe: GCGGGTTTGACCTGACTACAGTACCACTTTATCATCAATCGAAATTGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807