| DM7387 |
C. elegans |
pha-1(e2123) III; raEx387. Show Description
raEx387 [T05G5.1p::Y57G7A.10(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7388 |
C. elegans |
pha-1(e2123) III; raEx388. Show Description
raEx388 [T05G5.1p::Y9C2UA.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7391 |
C. elegans |
pha-1(e2123) III; raEx391. Show Description
raEx391 [T05G5.1p::Y48C3A.16(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7392 |
C. elegans |
pha-1(e2123) III; raEx392. Show Description
raEx392 [T05G5.1p::T22C1.6(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7393 |
C. elegans |
pha-1(e2123) III; raEx393. Show Description
raEx393 [T05G5.1p::ZK643.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7396 |
C. elegans |
pha-1(e2123) III; raEx396. Show Description
raEx396 [T05G5.1p::ZK1098.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7397 |
C. elegans |
pha-1(e2123) III; raEx397. Show Description
raEx397 [T05G5.1p::C48D5.2(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7398 |
C. elegans |
pha-1(e2123) III; raEx398. Show Description
raEx398 [T05G5.1p::K08E3.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7399 |
C. elegans |
pha-1(e2123) III; raEx399. Show Description
raEx399 [T05G5.1p::Y53G8AR.8(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7414 |
C. elegans |
pha-1(e2123) III; raEx414. Show Description
raEx414 [T05G5.1p::pat-6(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7418 |
C. elegans |
pha-1(e2123) III; raEx418. Show Description
raEx418 [T05G5.1p::F36F2.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7420 |
C. elegans |
pha-1(e2123) III; raEx420. Show Description
raEx420 [T05G5.1p::W01A11.2(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7421 |
C. elegans |
pha-1(e2123) III; raEx421. Show Description
raEx421 [T05G5.1p::ZK1127.10(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7427 |
C. elegans |
pha-1(e2123) III; raEx427. Show Description
raEx427 [T05G5.1p::T15B12.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7430 |
C. elegans |
pha-1(e2123) III; raEx430. Show Description
raEx430 [T05G5.1p::F22F7.7(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7431 |
C. elegans |
pha-1(e2123) III; raEx431. Show Description
raEx431 [T05G5.1p::ZK1128.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
| DM7438 |
C. elegans |
+/mT1 II; pxl-1(ok1483)/mT1 [dpy-10(e128)] III; raEx438. Show Description
raEx438 [pxl-1p::pxl-1a(cDNA)::GFP + rol-6(su1086)]. Rollers. Transgene does not rescue ok1483 L1 lethality. Transgenic (Rol) heterozygotes segregate rolling non-Dpy (heterozygotes carrying raEx438), non-rolling non-Dpy (heterozygotes without the array), arrested L1 (ok1483 homozygotes) and sterlie Dpy (mT1 homozygotes). Pick rolling non-Dpy and check for correct segregation of progeny to maintain. Reference: Warner A, et al. Mol Biol Cell. 2011 Jul 15;22(14):2551-63.
|
|
| EU828 |
C. elegans |
dhc-1(or195) I. Show Description
Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.
|
|
| GC363 |
Escherichia coli |
E. coli. Show Description
Bacteria. E. coli HT115(DE3) bacterial strain carrying pGC8. pGC8 is a partial cDNA of him-14 (ZK1127.11) cloned into the Timmons and Fire "double T-7 vector" L4440. The source of the cDNA is Yuji Kohara's clone yk240h12. pGC8 was constructed by inserting the 1.65kb KpnI/SacI fragment of the him-14 cDNA (from base pair 1071 to 192 base pairs beyond the stop codon) into the same sites in L4440. HT115(DE3) carrying pGC8 should be selected in the presence of 50 um/ml tetracyline and 100 um/ml ampicillin. Prior to an actual feeding experiment, it can be grown in liquid in the presence of amp alone (no tet) and then seeded onto NGM plates containing amp and 1 mM IPTG. This technique does not work well if the cells are old; therefore, the strain should be seeded onto IPTG-containing plates from a fresh overnight that was grown from a colony on an amp/tet plate. Biosafety Level: BSL-1. For more info see http://www.wormbook.org/wli/wbg17.1p32/
|
|
| GR1337 |
C. elegans |
daf-2(e1370) III; njEx38. Show Description
njEx38 [unc-54p::daf-2(cDNA)::unc-54 3'UTR + unc-54p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
|
|
| GR1340 |
C. elegans |
daf-2(e1370) III; mgEx373. Show Description
mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
|
|
| GR2107 |
C. elegans |
daf-2(e1370) III; mgEx371. Show Description
mgEx371 [dpy-30p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
|
|
| GR2118 |
C. elegans |
daf-9(e1406) dpy-7(sc27) X; mgEx663. Show Description
mgEx663 [dpy-7p::daf-9B(cDNA)::GFP + mec-7::GFP]. Pick GFP+ to maintain. GFP fusion containing 0.4 kb dpy-7 promoter and daf-9 isoform B cDNA. Reference: Mak HY, Ruvkun G. Development. 2004 Apr;131(8):1777-86.
|
|
| GZ264 |
C. elegans |
unc-119(ed3) III; isIs17. Show Description
isIs17 [pGZ295 (pie-1p::GFP::pcn-1(W03D2.4)) + pDP#MM051 (unc-119(+))] Maintain at 25C if possible to avoid possible germ line silencing. The entire coding sequence of PCNA (PCN-1, W03D2.4) was PCR-amplified and the resulting fragment cloned into pie-1::GFP germline expression vector to generate pGZ295, which was co-bombarded with pDP#MM051, which carries an unc-119 cDNA. The transgenic line behaves as though the two plasmids have been jointly integrated.
|
|
| IX3597 |
C. elegans |
kyIs140 I; vyEx1510. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1510 (ceh-36p::die-1(cDNA) + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1510 show 2AWC(OFF) phenotype.
|
|
| JAZ454 |
C. elegans |
jlgEx220. Show Description
jlgEx220 [nep-2p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in nep-2 expressing cells, co-injected with a nuclear GFP intestinal marker. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
|
|
| JAZ515 |
C. elegans |
nep-2(ok2846) II; jlgEx251. Show Description
jlgEx251 [myo-3p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in myo-3 expressing muscle cells, co-injected with a nuclear GFP intestinal marker, in nep-2(ok2846) mutant background. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
|
|
| JH3197 |
C. elegans |
gtbp-1(ax2053[gtbp-1::GFP]) IV. Show Description
Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1 between IV: 10127266...10127267. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3199 |
C. elegans |
gtbp-1(ax2055[gtbp-1::GFP]) IV. Show Description
Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3201 |
C. elegans |
fbf-2(ax2057[fbf-2::GFP]) II. Show Description
Maintain at 20-25C. ax2057 was produced by mutation of the sgRNA site and insertion of GFP cDNA at the C-terminus of fbf-2. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of fbf-2: ATCATCGCCGTGACTACCA(GFP) between II:6089145...6089165. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3203 |
C. elegans |
mes-2(ax2059[mes-2::GFP]) II. Show Description
Maintain at 20C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of mes-2 between II:14388297...14388298. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| MAD63 |
C. elegans |
dqSi1 II; unc-119(ed3) III. Show Description
dqSi1 [mex-5p::atx-2a(cDNA)::GFP::tbb-2 3UTR + unc-119(+)] II. Made by injection into strain EG6699; insertion confirmed by sequencing. dqSi1 rescues atx-2(ne4297). Reference: Gnazzo MM, et al. Mol Biol Cell. 2016 Oct 15;27(20):3052-3064. (PMID: 27559134) Del Castillo U, et al. Traffic. 2019 Jun;20(6):436-447. (PMID: 30989774)
|
|
| MAH97 |
C. elegans |
rrf-1(pk1417) I; muIs109. Show Description
muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.
|
|
| NFB2468 |
C. elegans |
zdIs13 IV; vlcEx1288. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB2471 |
C. elegans |
zdIs13 IV; vlcEx1290. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB509 |
C. elegans |
zdIs13 IV; vlcEx284. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su1006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| OG1110 |
C elegans |
ogt-1(dr20) III; drIs4 IV; drEx468. Show Description
drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx468 [ogt-1p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Over-expression of OGT-1 in presumptive null mutant ogt-1(dr20) background. gpdh-1p::GFP is induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
|
|
| OG1119 |
C. elegans |
ogt-1(dr20) III; drIs4 IV; drEx469. Show Description
drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx469 [dpy-7p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Hypodermal expression of OGT-1 rescues presumptive null allele ogt-1(dr20). gpdh-1p::GFP is induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
|
|
| OG1120 |
C. elegans |
ogt-1(dr20) III; drIs4 IV; drEx470. Show Description
drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx470 [nhx-2p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Intestinal expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
|
|
| OG1121 |
C. elegans |
ogt-1(dr20) III; drIs4 IV; drEx471. Show Description
drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx471 [myo-3p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Muscle-specific expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
|
|
| OG1122 |
C. elegans |
ogt-1(dr20) III; drIs4 IV; drEx472. Show Description
drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx472 [rab-3p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Neuronal expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
|
|
| OG496 |
C. elegans |
drSi12 II; unc-119(ed3) III. Show Description
drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+) II. Human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules only after prolonged (1 hr) 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
| OG497 |
C. elegans |
drSi13 II; unc-119(ed3) III. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules after >1 min 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
| OG528 |
C. elegans |
hsf-1(sy441) I; drSi12 II. Show Description
drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy human HSF1 (drSi12) in hsf-1(sy441) hypomorph. drSi12 includes human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
| OG532 |
C. elegans |
hsf-1(sy441) I; drSi13 II. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy C. elegans HSF-1 (drSi13) in hsf-1(sy441) hypomorph. drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
| OG566 |
C. elegans |
drSi28 II; unc-119(ed3) III. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules at a reduced rate compared to wild type immediately after 1 min 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
| OG575 |
C. elegans |
hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); drSi13 II. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi13 in the background of balanced hsf-1(ok600). drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP rescued ok600; drSi13 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
| OG580 |
C. elegans |
hsf-1(sy441) I; drSi28 II. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in hsf-1(sy441) hypomorph. drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
| OG584 |
C. elegans |
hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); drSi28 II. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in the background of balanced hsf-1(ok600). drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP ok600 homozygotes (not rescued by drSi28), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
| OG636 |
C. elegans |
drSi41 II; unc-119(ed3) III. Show Description
drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|