Search Strains

T12D8.8. External left primer: GCTGCAGGAATCACTGACAA. External right primer: GAGACGCGAGGAAGAACAAC. Internal left primer: TGGGTCTTCCACCAAAGAAG. Internal right primer: GCGCAAATGCACAGAATATG. Internal WT amplicon: 1339 bp. Deletion size: 689 bp. Deletion left flank: AGCCTTGTGCCGAGTCTGGGTTGATAGAGA. Deletion right flank: GAATTGAAGTGTTTATTCAATTTGTTTGGA. Validation: gk3264 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK484.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable, carrying deletions in T19B4.3, dhhc-11, twk-4 and F26D11.2, plus a large multi-gene deletion on LG V. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4B.12. External left primer: GAAAAGGCAAAATACGACAAGG. External right primer: AATCGCGAAAAATTTCCAGTAA. Internal left primer: CAAAAATGTTGTCGATTTACGAAG. Internal right primer: CTTTTCTTACCAAGCATCGAATTT. Internal WT amplicon: 1049 bp. Deletion size: 233 bp. Deletion left flank: AGCGTGAGGGATTGATTCGAGCAAGACTTC. Deletion right flank: AATTTTGTGTCAAAAAATGGAAGGTAAAAA. Validation: gk3119 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y60A3A.12. Strongly Him, sickly, slow-growing. External left primer: GAGTTTTAGCGATTGCTCGG. External right primer: CGCGATTTTCGTATTTTCGT. Internal left primer: AAATTTCAAGGTTTTCGGCA. Internal right primer: GCGCAATTTTCTTCGTTTTT. Internal WT amplicon: 1171 bp. Deletion size: 390 bp. Deletion left flank: CGCCCGTACCACTGATCGATCGGATTTCTT. Deletion right flank: CAGTAGAAAACTACTCTATCAATGGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53G2.9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01D4.6. External left primer: CGCGTTGAAGTCAGTTGTGT. External right primer: GACTCCTGTTGGATTGGCAT. Internal left primer: CTGCCACATCAGTGTTGCTT. Internal right primer: CAAAGCCTCTCAGTGCGATT. Internal WT amplicon: 2450 bp. Deletion size: 1104 bp. Deletion left flank: TCCATAAGCGTCAACCTCCTAAAAATTAAA. Deletion right flank: ATAAAATGAGATTGGAAAATAGAATGAATA. Insertion Sequence: AAAATAAAAA. Validation: gk3299 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73F8A.19. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03D8.6, C11E4.3, F13D12.4, W03D8.5, F48E2.4, F49E2.7, F48E2.9, C11E4.1, C11E4.2, C11E4.17, C11E4.15, C11E4.14, C11E4.10, C11E4.9, C38C5.2. The gk3108 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATTTGGCTGGGTCAACTTT. External right primer: TATTGTAAGGATCTGCCCCG. Internal left primer: TTGCACCAAAATGATGGAAA. Internal right primer: CTCAGACAACAAGATCCGCA. Internal WT amplicon: 2496 bp. Deletion size: 1960 bp. Deletion left flank: GTAGGAGTTGTTGCGTGGAAGGTCACACGC. Deletion right flank: AAATTGCGAACACAATTTTGAAATTCAAAA. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38F1A.1. External left primer: GCACCCCATTGTTGAACTTT. External right primer: ATGCCACGTAGCAAAAATCC. Internal left primer: TTCCCAAACACAAGAATCCC. Internal right primer: GCTAAGAGATATCGCGCGTC. Internal WT amplicon: 1616 bp. Deletion size: 493 bp. Deletion left flank: CTTCCCGGTGATTGTAAGGTCTTTAGACAT. Deletion right flank: TGTTTTTTATGTTGTTGTTTTTAAAATTGT. Validation: gk3300 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B9.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable, carrying a deletion affecting sdhd-1 and ilkp-2. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53B6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable, carrying a deletion in W02B12.12. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C44H4.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable, carrying a deletion in mpc-1. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable, carrying a deletion in srz-96. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09G4.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C55B7.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable, carrying deletions in srx-68 and nhr-195. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04F6.4. Lethargic and a bit flaccid. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable, carrying a deletion in lys-6. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54F6.10, C54F6.9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ceh-99. Homozygous viable deletion. External left primer: TGGATATCTTTTTGGCCAGC. External right primer: GCCTTGAAATGTTCCGTTGT. Internal left primer: AGGGCTCAATGAGAAGCAAA. Internal right primer: AATCCCTGTCTCCTCGGTTT. Internal WT amplicon: 1484 bp. Deletion size: 496 bp. Left flanking sequence: TGAAGAGCCACGATCTCCGAGTATTGAGGT. Right flanking sequence: AATGGCTAGTGTGGAGGAAGTAAAAGTAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W10G6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28F8.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

alh-8. Homozygous viable deletion. External left primer: CGCGTGTATTTTGTGGCTTAT. External right primer: CTCGTTCCAAACGGAATGATA. Internal left primer: ATCCGAATCGTCAGAACCAC. Internal right primer: CTGTGGGAACGACATTTGTG. Internal WT amplicon: 2065 bp. Deletion size: 1196 bp. Left flanking sequence: CTTCAAAACTTCAAATAATATTCTAATTTC. Right flanking sequence: GCAATCCAAGGCCCGTGTCCTCCGTCTTAT. Insertion sequence: CTGATCTCCAT.Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09A5.13. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25H5.1c. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26E4.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25F8.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK757.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46C5.3. External left primer: GGATCATGCTCATCTCCGAT. External right primer: CGGTTTCTTGCTTCATCCTC. Internal left primer: GACGCCAACAAATTGGAACT. Internal right primer: ATTTGAAACAAAGAAGGCGG. Internal WT amplicon: 1158 bp. Deletion size: 651 bp. Deletion left flank: AAGTGTTATGCATTATTCAGCTGATTCGTA. Deletion right flank: CTCCATTAAATCTAACAACTACTGTTAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK930.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T14G10.6 . Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45B8.4. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33B4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41H10.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F8.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37D6.6. Mildly Unc, with exaggerated sine wave. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G1BL.2. Superficially wild type. [NOTE: According to WormBase, gk186 is a 548 bp deletion. Left external: gtcgggttttgatgcacttt Right external: atctttccatcgtttccacg Left internal: aaattcgatttttcgcgatg Right internal: caattgacgcaatttgcact] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D1014.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58E1.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T14G12.2, T14G12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y2C2A.1/tag-80. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54D2.5. Mildly Unc, slow-moving. External left primer: TCGGAGATGGTGATTCTTCC. External right primer: TGATGGAGTCCGGATAAAGC. Internal left primer: TTGCTTTCTCGCATCCTCTT. Internal right primer: TTCCAAGCTCTGGTGGTTTC. Internal WT amplicon: 1379 bp. Deletion size: 267 bp. Deletion left flank: GCGCCACAAAGTAAAGAGCTGCCCATGGGT. Deletion right flank: CTCGAGATAACTTGAGCGCTGGTACACTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807