Search Strains

Y46C8AL.3. External left primer: AAAAACCCTGACCAAAGGCT. External right primer: AATCGCATGGTTACGCAAAT. Internal left primer: AGACTGACATCCCACAAGCA. Internal right primer: ATTCGGAATCAGGGGAAAAT. Internal WT amplicon: 1151 bp. Deletion size: 507 bp. Deletion left flank: TTCATTGCTTCCAATACACCATCCGGCGGC. Deletion right flank: TGCTAATCTTGATGCTTCCGGTTTCGCTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03G6.3. External left primer: GGTGAATTCTCAGTGCACCA. External right primer: CGGAAAAGCTGGAGTAGACG. Internal left primer: ACTTAGAGTTGCCGACCAGG. Internal right primer: TTATTGGTTTGCACATTGCC. Internal WT amplicon: 1269 bp. Deletion size: 572 bp. Deletion left flank: TTGTTCCTGGCTTTGTAATCAGTACAACAC. Deletion right flank: AAGCATCGGTGGTTCAGTGGTAGAATGCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.13. External left primer: CTTGACGGCATTTCTCATCA. External right primer: CATCGCACAAAATTGCAAAC. Internal left primer: ACTTTTTGAACAAACGCAGC. Internal right primer: CGCAAAAGTGGCATGGTATT. Internal WT amplicon: 1292 bp. Deletion size: 741 bp. Deletion left flank: TCAAATGATGGAACAGTTTTCGAAATCAGT. Deletion right flank: AAGTTTTTATTTAACCAAAAGCAATTACGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11G12.1. External left primer: AAAACACAGGCACCTTGGTC. External right primer: TCTGATTGGGGAACTTGGAT. Internal left primer: CAAAGAATGGAAAGGCAAAG. Internal right primer: ACTAGGATGAGATGGGCAGC. Internal WT amplicon: 1336 bp. Deletion size: 982 bp. Deletion left flank: TCATGTAAGCTCGGAACATGTGAACAAACT. Deletion right flank: AAAACGGGCAGAATTGTAGATTTGCTGCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33C12.9. External left primer: AAAACAAAGCAACTCCAGGC. External right primer: CCCAAAGTTTTGACACCCAT. Internal left primer: AGCCTGTGATTCTAGCCAGC. Internal right primer: AGATTCGGTCAAAAACCCAG. Internal WT amplicon: 1235 bp. Deletion size: 598 bp. Deletion left flank: CGTCAATAAAAAGGTTTTTGTGGTGCGTTG. Deletion right flank: AGGTTTGTAGCTTAAATTTGAAGATTTTCG. Insertion Sequence: GTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02F5.7. External left primer: GGAGCATACTTGCGTTGGAT. External right primer: GTGTCGAGACCGGGTACTGT. Internal left primer: ATCTAACTGGCAGCGCGT. Internal right primer: CGAACGATTGCTTCTTTTGA. Internal WT amplicon: 1100 bp. Deletion size: 707 bp. Deletion left flank: TCTAACTGGCAGCGCGTCGACTTATTCACA. Deletion right flank: AGTACTGGAATTATCTGGATGCACACTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15A2.1. External left primer: ATTCGTCTGTTCCGTTTCCA. External right primer: GATGACACAACCCCCTCACT. Internal left primer: CTTAATTGCATCGCAACCAC. Internal right primer: TGGATTTGACCATTTCAGGC. Internal WT amplicon: 1248 bp. Deletion size: 462 bp. Deletion left flank: CTCAAGGATGCCCAGACGGGCCACCAGGAG. Deletion right flank: AGGATGGTACTCCAGGAGAACCAGGTGCCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK154.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48C1.4. External left primer: AACGATAGGAGACACGGTGG. External right primer: TGTGGTTGTTTTCGTTGCAT. Internal left primer: CAAGTTGAGAGTCCGCAGTG. Internal right primer: ACCATAAACTTGTTCGCGCT. Internal WT amplicon: 1143 bp. Deletion size: 523 bp. Deletion left flank: TTAGACAACTAACCATAGAGCGTGCAAATC. Deletion right flank: TGTTTCAGTGTTCTCCTTCCTGAAAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06A12.3. External left primer: CAATGCAACGCCAATTGTTA. External right primer: CTCATCAATGCCTTGCTCCT. Internal left primer: TCCATTGTTTGAAGAGTGCTG. Internal right primer: CGAATTGGCTAAAAACTCGAA. Internal WT amplicon: 1192 bp. Deletion size: 336 bp. Deletion left flank: TATGTTCCATTGTTTGAAGAGTGCTGTTCT. Deletion right flank: TGAATAGAAAACGTCACGAAGTGGTGAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27C7.2. External left primer: ACACAAATTGCCAGATGCAG. External right primer: TCAAGAAAAAGCAACAGCCA. Internal left primer: TTCCACATCTTGCTTTGATTTG. Internal right primer: CGGAAAATTCCTGCACAACT. Internal WT amplicon: 1166 bp. Deletion size: 411 bp. Deletion left flank: TATGAAGACTACTGTAGAATTACCGTAATT. Deletion right flank: GTTGCTTTTGCTATGCATAAGTTCATGGTT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25F10.2. External left primer: TCCGACTTTTCAGCCTGATT. External right primer: AGCATCGTAGCCCTCTGAAA. Internal left primer: GATATGTCCAGTGGCTGCCT. Internal right primer: CTCACTGGGTGCCATAATCC. Internal WT amplicon: 1134 bp. Deletion size: 783 bp. Deletion left flank: CCAATGTCTGCTGCTGCCGATCAACACGCG. Deletion right flank: AAAAAATCGAAAAAAGGTTTGTGATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04G3.6. External left primer: ACGAGTACGGAGGTTGAAGC. External right primer: GCACCAACTGGACCACTTCT. Internal left primer: ATCCCTTGGACTTGCTGTTG. Internal right primer: CGAGATTCCTTATTTGACCGA. Internal WT amplicon: 1322 bp. Deletion size: 734 bp. Deletion left flank: ATATATGTATATTTCAGATAATCATGGGTC. Deletion right flank: CTTTCTGGAAGCTTTATTAGCCTAAAGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01F6.5. External left primer: CAACTCCCCCAAATTGGTAA. External right primer: GACGAAGGGATGATATGGGA. Internal left primer: TTTTTGATGTCACCTACCTATTCTA. Internal right primer: TTTGTTCGCCGTTCAATATG. Internal WT amplicon: 1251 bp. Deletion size: 617 bp. Deletion left flank: TCTCCAGATACTCCATCCACCTAGTCTATC. Deletion right flank: CGTGAACTTCAACGAGCACGGAAAACCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02F3.4. External left primer: ATTGTTCAGCTATCGGCTCC. External right primer: AGCTGCTGGAGTTGGAGGTA. Internal left primer: ACTCACCGCTCCAGGATG. Internal right primer: TGAGGTTGGTGAATAAGGGA. Internal WT amplicon: 1145 bp. Deletion size: 476 bp. Deletion left flank: GACACGACGTTCCCTACCGAAAGCGGACCG. Deletion right flank: AATTTAAACATTAAAAACCATTTCAGTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28D1.3. External left primer: TTCCTATCAATCACCCCCAG. External right primer: AGTTTTACGCGGCTGTTGTT. Internal left primer: TTTCCTAAACCTTACGGCCC. Internal right primer: CCGTGTTCCTTTTGAAGCTC. Internal WT amplicon: 1285 bp. Deletion size: 583 bp. Deletion left flank: TTTAGCATGAACTTTCAGAACTCGGAGCAA. Deletion right flank: CAGTTGATACCTTTCTACTATCGAATGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK6.11. External left primer: ATCAGTCATAAGGCGATGGG. External right primer: CCATTTCAATAAACCGGTCG. Internal left primer: AAGGCTTCAAGGCTGTCAGA. Internal right primer: GTGGCTCGGTTTCACACTTT. Internal WT amplicon: 1209 bp. Deletion size: 496 bp. Deletion left flank: CAGCGTACAGATATGCCAGAGCAGTAGAGT. Deletion right flank: TAAATATTATACGGCGGGTAAACTTTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17E4.20. External left primer: TTCCGTTGGGGTAAAATCAA. External right primer: ACACGAAGGACGAAAGTTGG. Internal left primer: GGAATCAAAACGGATGGTTG. Internal right primer: GCGGTATTAGGAATTTTTGGG. Internal WT amplicon: 1157 bp. Deletion size: 609 bp. Deletion left flank: GCGATGTTGAATGAAGCTATGGAAGATGAT. Deletion right flank: CAAATGGAAAAGAACTCTGAGCTACAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10H9.2. External left primer: ATCACAAACCAATTGGGGAA. External right primer: TAATCCGGCTGGAAGAAATG. Internal left primer: CCCTGCGTATGCTAATTGGT. Internal right primer: TCCGGTCTAGTGGTAATCCG. Internal WT amplicon: 1147 bp. Deletion size: 660 bp. Deletion left flank: CTGATTTTATCGTTGAACGACGCGATAATC. Deletion right flank: CTTGTACAACATTACGTTTTTGATCTTCGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03E5.3. External left primer: AAAATGCGTATTTCGCAACC. External right primer: AATTTCGTTCGATGACACCC. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: TGAAGAGGAAAGACTCGGTAAAA. Internal WT amplicon: 1155 bp. Deletion size: 246 bp. Deletion left flank: GAATTAAAATAATTTATTAATTTAAATAAC. Deletion right flank: TTCCAAAAAAAAACATAAATTTCGATTATT. Insertion Sequence: CAAAAAAAAACATAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4B.4. External left primer: AAACCGCATTTGTCCGAATA. External right primer: TGCCCCCACTAACCAATATC. Internal left primer: TGTCTTAAAGCAAACGTGCAA. Internal right primer: ACTACTGCCGGCTCTATCGG. Internal WT amplicon: 1181 bp. Deletion size: 351 bp. Deletion left flank: GTTTTGATAAAGGCTTCGAATCGGAAATTC. Deletion right flank: AGGCTCCATACTTTCTGTTTATGGTTATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38E10A.8. External left primer: GGAAACCACGACGCTATCAT. External right primer: CCGCGATCCAATTCTCTAAA. Internal left primer: ACCTGATAAATCCATCCGCA. Internal right primer: GTCCGACACTTTTTGGGTTC. Internal WT amplicon: 1216 bp. Deletion size: 550 bp. Deletion left flank: ACTTTATTCATAGAGATTTGAAGCCAGAGA. Deletion right flank: AAACGATGCGCGGAACCCAAAAAGTGTCGG. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10E9.1. External left primer: AGCTGAAAAATGCTGTCGGT. External right primer: TTAAATGTGCAATGGTCCGA. Internal left primer: TACTGCACCACCGTTCAAAA. Internal right primer: CAGCTTCCTCATTTTCTGTTCTT. Internal WT amplicon: 1235 bp. Deletion size: 625 bp. Deletion left flank: AGTTGCTGGACAAAACAGCCGTGAGGAAGC. Deletion right flank: GGATACTTGAAATAAAAGGGAGCAGGAATC. Insertion Sequence: TTGAAATAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11G11.2. External left primer: CGGACATTTTCCGTTCAACT. External right primer: GCATTCTGGTCCGTTTTGAT. Internal left primer: GGTGCCCAGTTGTAGAGCAT. Internal right primer: AGAAAGGAAAGACGCAGGTG. Internal WT amplicon: 1957 bp. Deletion size: 694 bp. Deletion left flank: TTTGGCACATGTGGGGGAGGATGGACAAGC. Deletion right flank: AAACTATCTACAGTAGTTCTACAGTATTCC. Validation: gk3046 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27D12.1. External left primer: GGAGCCGTCTCTCTCCTTCT. External right primer: ATGGGTCAAAAATTGCTTGC. Internal left primer: ACGTACGCTCTCTTCTACCG. Internal right primer: ACTGCAAGTAGCCGACACCT. Internal WT amplicon: 1304 bp. Deletion size: 672 bp. Deletion left flank: TCCTCTTCTCCCCAATCTATCTCTCCAAGG. Deletion right flank: CTAAAAAAAACTTGTACAAATCTTTGCTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71F9B.3. External left primer: AGCCCTGACTGGTTCACATC. External right primer: AAAAAGGGAATTTTGGTGGG. Internal left primer: GCAAAAGGTCTTGGACGATG. Internal right primer: TCATTCCATGTGATCTCGGA. Internal WT amplicon: 1215 bp. Deletion size: 860 bp. Deletion left flank: AGCGGCTTCATTTGGTGCTCGGCGTCGTCG. Deletion right flank: TTCTCCGTTCAAATCGTCGCCGTTTTCCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02E12.2. External left primer: TTTTGGGCGTTTTTCTTACG. External right primer: ACAGAAGCTGTTGCCGAGTT. Internal left primer: GGAAATTTTGAACGACCACAG. Internal right primer: GAGTTGTTTTACAGGAATTCTCCA. Internal WT amplicon: 1136 bp. Deletion size: 392 bp. Deletion left flank: TTTCAAATATTCCATGACCACCCAAAAAAA. Deletion right flank: CATCCGCACAAGCTGTCTTCATCGTACTGT. Insertion Sequence: ATCTCGCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33A12.7. External left primer: ATGTCCTTTTCCATCCACCA. External right primer: CACGTCTATTTTGGCCGTTT. Internal left primer: TTTGCAGGAACCGCTTTATC. Internal right primer: GCAGGTAGACATAGGCAGGTG. Internal WT amplicon: 1353 bp. Deletion size: 748 bp. Deletion left flank: CGATTTTGAACTGAGCACTGACTTCATTGT. Deletion right flank: ACATCTCTTTCATATGCACGAAAATGTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21A3.6. External left primer: CAAATTGGCGAACTTCATCC. External right primer: AAATCCGTGATTTTTCGCAC. Internal left primer: CAAGCCTGTTTATAGACTTTTGGG. Internal right primer: AATTCCACTTTCCGAGCAGA. Internal WT amplicon: 1231 bp. Deletion size: 542 bp. Deletion left flank: ATACTGATGAATAATGCGTATCTAATAACT. Deletion right flank: CTGCAAGGCACGGCAGGCATTTTTGCGCCT. Insertion Sequence: GCAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R04B5.5. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 247 bp. Deletion left flank: ATTCCAAAGCCTGGGCCAAATCAGGTGCTT. Deletion right flank: TGTGAGCACTGCAAAACTGGAAGATACAAT. Validation: gk3180 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13H2.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28H1.2. External left primer: TTTTTAAGTCCGGCAAATGG. External right primer: ATGTTTTTGCTGTGAAGCCC. Internal left primer: AGGCGCACACTATTTTTCGT. Internal right primer: CCGGCGTATAGAAACCAGAG. Internal WT amplicon: 1306 bp. Deletion size: 543 bp. Deletion left flank: GATCAAGAAGCTCTCCGGTGAGAACATCTC. Deletion right flank: ACAAAGCTCGATTCTTCTCTCTTTTCTGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06A10.1. External left primer: CAGCTTGTCTCCCGAATCTC. External right primer: AGGCCAACAATAGCCAAAAA. Internal left primer: CTCGTCTTTCTCGCGTTTTC. Internal right primer: TTTGAGCAATTCTGGACTAAAAA. Internal WT amplicon: 1270 bp. Deletion size: 448 bp. Deletion left flank: GACGTGAAGGCTTCACGAATGTGTTGGAGC. Deletion right flank: ACAGAAAAATGGGCGGGGCACAGTTTTGCA. Insertion Sequence: AGAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20G5.6. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 369 bp. Deletion left flank: TTTGGAGCAACGTGTTTAAAGTGTTGAAGA. Deletion right flank: GGTTGGCAAGTGTTAAAATGTCCAAATATC. Validation: gk3235 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C41A3.1. External left primer: AAGCTTGGCGATCAGGTAGA. External right primer: CAGTTGACTCAATTTCCGCA. Internal left primer: ACGGCATAATACCGAACCAG. Internal right primer: TGCTCGTCAACAATGTTCGT. Internal WT amplicon: 1141 bp. Deletion size: 689 bp. Deletion left flank: CTCAATCCGACTCTGCGATGGAGGATATTT. Deletion right flank: GATCTGCCAGCTATTTGCTTGTGGGTTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC84.2. External left primer: GCGGTTCGGATACGAAAATA. External right primer: GTGCCTGCAAGGAGACCTAC. Internal left primer: GCAAATTATACACAGGATCCATCTAC. Internal right primer: CCTGCTCCAAAAGTAAGCCA. Internal WT amplicon: 1290 bp. Deletion size: 442 bp. Deletion left flank: ACTTGGGATGGTCGAAATATTGGCATTTTC. Deletion right flank: AGAGCTTACCCGAGTGAGTTTTTAGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12F6.5. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 470 bp. Deletion left flank: AATGGAAACCTCATGGAAAGACTCGAAGCA. Deletion right flank: TATTCCCAATATTCATGTTCGAACAGTTTT. Insertion Sequence: CTCGATATTCTCTTCGTAATCAGGGATTATTCCGAGTTTCTGGTTCACAATCGGAAATT AATCGATTCAGAGAAGCTTATGAAAGAGGAGAGGATCTATTCCAGTATCTGGGAGGATC TATTCCAGTATCTATTCCAG. Validation: gk3182 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y63D3A.3. External left primer: TCGCCCCAAAAATAAGTGAC. External right primer: TCCGCCTTCAACTAAACCAC. Internal left primer: CACATGGGGATTGAGGTCAT. Internal right primer: CTTTGCCGCATGCAAAAT. Internal WT amplicon: 1172 bp. Deletion size: 467 bp. Deletion left flank: TAAAATGAGAACTTTGAAGCTTAGGTACCA. Deletion right flank: AAGCTATGAACTTATATACTACATATTTTT. Insertion Sequence: CGAAAGAAAGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E01A2.10. External left primer: CAAAACCCAGTGCTCTGTCA. External right primer: AGGCAAGCATGTCCTCAAAT. Internal left primer: TGAACAAAACCCAAGTTCCC. Internal right primer: TCGGCAAATTGATAAAATGCT. Internal WT amplicon: 1304 bp. Deletion size: 528 bp. Deletion left flank: CATCTTTCTTTATCCAATGAGATATTCCAT. Deletion right flank: AACCGCCTCTCCTGGGCACGTGTTCTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable, carrying a deletion in Y53G8AR.6. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11E6.1. External left primer: AAAAACGTTCTAAGGCTAAATTGCT. External right primer: AAATTCAGCACAATAGAGAATCCTG. Internal left primer: CGGTTTTAATGGCTCCAAAA. Internal right primer: CTTGAGCAGTTCGGTTGACA. Internal WT amplicon: 2099 bp. Deletion size: 464 bp. Deletion left flank: TTTTAAAAGATTTTTCGAAGCCTATTCATC. Deletion right flank: ATTCATCATGGCCCATTAATGGGTGACTGG. Validation: gk3287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27D6.4. External left primer: ATGTGATGGAGTGGGTGGTT. External right primer: GTTGTACCGCCAACGTCTTT. Internal left primer: ACACGAAAGGGGGAGAAAAT. Internal right primer: GATTGGACGGATCAGAAGGA. Internal WT amplicon: 1448 bp. Deletion size: 987 bp. Deletion left flank: AAATGGTTTACCCTAGGGAGAAAATGGTTT. Deletion right flank: TGAAATGTTTCATTATTACTTTTAGAAAAA. Insertion Sequence: GTGTTTCATTATATTTCATTATTT. Validation: gk3293 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.5. External left primer: TGTGAATCATGCAAATCGGT. External right primer: TTCACTGCCATTGGTACGAG. Internal left primer: CGCCTACAAACTTGCTCCAT. Internal right primer: CATCTCACCATAGTTCCAAGAGC. Internal WT amplicon: 1196 bp. Deletion size: 699 bp. Deletion left flank: GAATTTTCAGGCTGACACCTCCGCTGTATG. Deletion right flank: TTTATATTTTCAGCAAGGAACAGCTGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 407 bp. Deletion left flank: CAGAGGCGTTGTTGTTGGTGAGTGACTAAT. Deletion right flank: TTTGTAAATTCTGAAAAATTGCCACTTTTA. Validation: gk3296 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.11. External left primer: TTGGCTGCTTGTATCGATTG. External right primer: CGAAAGACTGCGAGGAAAAC. Internal left primer: GTTTCCCTGTCGTATTTCGC. Internal right primer: ATCATTGAATCCGTTGCACA. Internal WT amplicon: 855 bp. Deletion size: 260 bp. Deletion left flank: CAGACAAGTGATTTTTGAACTATTTCGTCA. Deletion right flank: TCCTTCGCCGCTCCACCACCAAGACCAGGT. Validation: gk3124 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0228.8. External left primer: CATACATAGAGTGCCCAAGAGATG. External right primer: ATCGGTTTTTCAAATTTTGTCATT. Internal left primer: ATTTGTTTGCTTCGGAACAGAT. Internal right primer: TTTTTGGAGCTGTTTTGGAAAT. Internal WT amplicon: 1734 bp. Deletion size: 306 bp. Deletion left flank: CAACTTCTGCATAATAATTGCTCAAGAATG. Deletion right flank: CAATACTTATTGATAAGAAAAAGACAAATA. Validation: gk3093 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13F2.3. Unc. External left primer: GCAAGCTTCTCGGTAAAACG. External right primer: GCCCAGCCAATATATTCCAA. Internal left primer: ATTGCTGATTTGGGGACATC. Internal right primer: TCTAATTTCCTGTCAGATTCAGG. Internal WT amplicon: 1277 bp. Deletion size: 588 bp. Deletion left flank: TGTAGTACCAGATGGGCCCGGCGGAGCAAA. Deletion right flank: GCTTGCCTTGCATACATTTGCTGCTGCCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45H11. External left primer: CGCGATGAGACCCATCTATT. External right primer: CGACAATGTGGTCGTTTTTG. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: ATGGAAGAGTGCAAGTTCGG. Internal WT amplicon: 1685 bp. Deletion size: 107 bp. Deletion left flank: GAGAGACGCAGCAGCTTACTACGCAGTTAT. Deletion right flank: AAATATATTATTGAGAAAAGAAGAAGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807