C54D2.5. Mildly Unc, slow-moving. External left primer: TCGGAGATGGTGATTCTTCC. External right primer: TGATGGAGTCCGGATAAAGC. Internal left primer: TTGCTTTCTCGCATCCTCTT. Internal right primer: TTCCAAGCTCTGGTGGTTTC. Internal WT amplicon: 1379 bp. Deletion size: 267 bp. Deletion left flank: GCGCCACAAAGTAAAGAGCTGCCCATGGGT. Deletion right flank: CTCGAGATAACTTGAGCGCTGGTACACTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Superficially wild-type. Reference: Singh J & Aballay A. Dev Cell. 2019 Apr 8;49(1):89-99.e4.

This strain is homozygous for a deletion (gk3041) in F13A2.8, detectable by PCR using the following primers. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1081 bp. Deletion left flank: AGCCAGGTTTGCTCAAGGTAAAAAATGCCT. Deletion right flank: TTTTACTCCTTTTTCTACAGTCGTTGTTAT. Validation: gk3041 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3023) in T24H10.1, detectable by PCR using the following primers. External left primer: GCACAGAAGGGTAGCTGGAG. External right primer: TTGGCTTCTGGCGTCTACTT. Internal left primer: ATGCGATAAATGGAGATGGC. Internal right primer: ACACGCGGTTATTAAGGTCG. Internal WT amplicon: 2047 bp. Deletion size: 568 bp. Deletion left flank: ATTAATACTCTCCGTCATTCTTTACCTTTT. Deletion right flank: AAATCTGCACAACTTCTACTTTCGGCACTT. Insertion Sequence: CATCTGCACA. Validation: gk3023 passed by CGH. Other deletions (gk3142, gkDf25) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28F3.1, M01D1.1. The allele gk1230 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CATGGTCAACGAAGCTGAGA. External right primer: GAGAGGCAGAACCGAAGTTG. Internal left primer: TGCGACGAGATCTTGAAGTG. Internal right primer: AAAGCACATTTGGGCAAGAC. Internal WT amplicon: 2703 bp. Deletion size: 1246 bp. Deletion left flank: TTATTCTCTTTTCCCCCAAATCCCCTATAT. Deletion right flank: GGCAAATGGATAGCACGGATCTGAAATTAA. The allele gk3036 was identified by CGH but not confirmed by PCR. Left flanking probe: CTTGTTGCCCATCTCTGATTTACAACTCGGCCCATAGCGTAATTAAAAAT. Right flanking probe: GATATCCCTTCGAGAATAATATCAAAGTTAAATGTATCTTCATGTCGTTG. Left deleted probe: CACTCCAATTTTCCACGAAAATGCTTTGGCTGCATATCATACAATATTCT. Right deleted probe: ACTACCAGTTCACGTGCAGTTTGAGTTTGTTTCATCAAACCCATTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3042) in ZK265, detectable by PCR using the following primers. External left primer: ATTTTGGCGCATATCTCACC. External right primer: AGGGTGCGATTAACGTTTTG. Internal left primer: GCGTTGGTAGGTTGTGTTGA. Internal right primer: GCACTCTGCGGGATTTCTAC. Internal WT amplicon: 2020 bp. Deletion size: 1123 bp. Deletion left flank: AAGAAGAACTGTGTGATGGGAAGCAGCAAA. Deletion right flank: AGACACTTGTGGATTCCTCGAGAAAAAGTG. Validation: No CGH probes for gk3042. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3071), it is homozygous for 323 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

madf-9. Homozygous viable deletion, detectable by nested PCR. External left primer: AACAAAACGCATAACCTCCG. External right primer: TCGGCCAAACTTCATTTTTC. Internal left primer: AAAGAGAGAAGAGGGAGCCG. Internal right primer: GGCCAAATCTTTGTGGTTTG. Internal WT amplicon: 1269 bp. Deletion size: 784 bp. Deletion left flank: CCTCCCAACCGCACACATACTACCAACGAT. Deletion right flank: TTAAATTGAGAAATGAAAAAAAAGGTCACG. Validation: gk3057 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37D8A.15, F37H8.4. The allele gk1055 was identified by PCR screening, has been validated by CGH analysis, and can be detected with the following PCR primers. External left primer: CGGCAAGCCTAGTAGGTAGAC. External right primer: CGGAGAGCAATGTTGAGTCCTC. Internal left primer: CCTTTGCCAGTTTTTTCCCTTTGG. Internal right primer: TTCTTACAGGCAATGGCTGGAC. Internal WT amplicon: 2702 bp. Deletion size: 652 bp. Deletion left flank: GAAAAACGAAAATTGGCAGTAGGCAGGCAG. Deletion right flank: ACAGAGAGTAGGTAGACAATAAGCAGGCAA. The allele gk3039 was identified by CGH and not confirmed by PCR. Left flanking probe: TGTTAAATATTGGCCAGAGTTGACTCAATCTTTAGTTAATTTGGCGTAGT. Right flanking probe: CATCTGCCGAATTTTCCTTTATAACATTCCAGAACAAGAACAGTATTGCT. Left deleted probe: ACAGTTTCAGATGCCCGCCAACATGCTCATCAACGGAATGCTCTTGAGCC. Right deleted probe: GAGCTATGGCTGCTGCTCTGTCACTGAATGCGATGGTTAAGGTAAACAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48D7A.2. External left primer: TGTGCCACTCACCGATGACAC. External right primer: CATCATCATGGCGCTACG. Internal left primer: GTCCTATCAGTACCTCATGGG. Internal right primer: CGAATACCTTGTACACGC. Internal WT amplicon: 2980 bp. Deletion size: 1312 bp. Deletion left flank: AACACACGTCAACCATGAACAAATCTGCTT. Deletion right flank: AAATTTCAAATTCATGCTTTCAAATCGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04F1.15, C54E4.2. The allele gk1083 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 575 bp. Deletion left flank: TGAATACCGTTAATTTTTTTTTTTTAATTA. Deletion right flank: TTCGCTGAAAAATATAATTTCTTTCTGGTG. The allele gk3053 was identified by CGH and not confirmed by PCR. Left flanking probe: ATTTTACATTAGTCCGTGAATTTCAGATACTACGCCGGATATGCTGATAA. Right flanking probe: GCGCGGGATCAGTTTGGGTCAACTGTTATGATGTTTTTGATCCTGCTGCT. Left deleted probe: TATGCTGATAAAAACCACGGAAAAACCATTCCCGTCGGTGGAGACTATTT. Right deleted probe: TGAATAAAGCTCTTCAAGTCGCAAATACTATCCGCGCGGGATCAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13B5.5, T13B5.6, T13B5.7, Y53F4B.25, Y53F4B.27, F55C5.6, F55C5.7. The allele gk1208 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AACTTCGGGAATGTCAATGC. External right primer: CAATTTTGGACCAACCCAAT. Internal left primer: GCCAGAGACCTTCCACAGAG. Internal right primer: ACTTTCAATTTCCGGACGTG. Internal WT amplicon: 2542 bp. Deletion size: 1329 bp. Deletion left flank: TCCCGGTTCTACGAATTCCAGAAGTAATAT. Deletion right flank: CTTCAGCTCTTTGAGCCGTTGCCACTAGCT. The allele gkDf19 was identified by CGH but not confirmed by PCR. Left flanking probe: AATGTGGAAAAGGGCTACTCGCTTGTCTATGCTGAAACGTAGGTTGTGAA. Right flanking probe: CACTTCATCTCAAGATTTCGTTGAGAAGTGTCGGTTGTATTGCCCCATGT. Left deleted probe: GATCTGGCAAAATGTTGTTGAAAACTTAAATTTTTCCACCAAGTTTTTGT. Right deleted probe: AATTGGGGATCCTTCTCCATGTGCCACAATATCAACCTGATTATTCGTAA. The allele gkDf20 was identified by CGH but not confirmed by PCR. Left flanking probe: ATGCTGTGAACGTGCTGGAATTCTATCGTTCCAAGGCGGAAAATGTATTC. Right flanking probe: GAAACTATGCGATTCGAGTGGAGAATAAGAAAAAGTCATCGTTGATTTCT. Left deleted probe: ATGTATTCCATTCTGTCGAACCCACGTGGCAACTCCTTCAAATGTTTTCG. Right deleted probe: TGGGAAAAGCCGGCCACCGCCATCTGGAAACTATGCGATTCGAGTGGAGA. The allele gk3058 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAAACCACTCTGGAAGACGATTTCATGGTTTTCGAGCCCAGTTCATGG. Right flanking probe: AATTCACTGTTTACCACTCTGTGAACCTGGATGTGTCAAGGGGTGCGACC. Left deleted probe: TGTTTATATTCCTGGAAACAGCATATAACCTTCTCTGTAGATTCAACGAT. Right deleted probe: AGTGTACAAGTGGCAGGTCACAACAGTATACTCTACGTACCAACTTCCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1, B0462.4. The allele gk1133 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 337 bp. Deletion left flank: TTTTTTTCAGATATTTAGGTTAGTCCACTT. Deletion right flank: GGGCACGCCCACTTTATACTATTTTGATGT. Insertion Sequence: TAT. The allele gk3031 was identified by CGH and not confirmed by PCR. Left flanking probe: TTATAAACAGAGACAAATTTAGACCAAAACTCTGTAGGAAAGTGAGTTTT. Right flanking probe: ACAGGAATATGAATTGAGTGATTGCTTGTGGTAGACTCTGTAGATGGTCT. Left deleted probe: AAGTGAGTTTTTCCGTGTGTTCTGTGGGATCAGGTGCTCCAAATCTTCCA. Right deleted probe: GCGCCAATGCTAATATTATACTTATATAAAAGCACTTAACAAGCTGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Unc-22 twitcher. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3072), it is homozygous for 65 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

C40A11.7, C40A11.8, C40A11.1, F56E10.1, Y38C9A.1, C50C10.2, F21H7.9. The allele gk1184 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: AATCACTTTCGGTGCAGCTT. External right primer: GTATGCCCCACAGTTTTGCT. Internal left primer: AGTATCGCGGCATTGTTAGC. Internal right primer: TGCTCAAGCTTGGAGAGACA. Internal WT amplicon: 2419 bp. Deletion size: 2042 bp. Deletion left flank: ACCGCAATTAATTCCAATTCTAAGGTTTAT. Deletion right flank: ACTGGCGTCTTACAGTAAATTTTGTGTGAC. The allele gkDf17 was identified by CGH but not confirmed by PCR. Left flanking probe: ATTCCGCGATGTCTCCTTAAATCTTTTGGCAGAGGTTCTCGATTATCCAT. Right flanking probe: ATTGATCGAAAGTTACGAAGACGTGGACTAGTCCCAAAATTCCTAGTGAC. Left deleted probe: GAAAATAGATTTCTACCACTGAACTGTTTTTCTTAACAAACTCATCGAAT. Right deleted probe: CTGTTGAGAACATATCTAGTATTAAGGAAGGAGGGAACTATTCCACAGGC. The allele gkDf18 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAATTTTCGAGGAAGATGAAGTTTATGCGGACGTCCAAAGTGTTGAAAA. Right flanking probe: GATTTCGCTGTGATAAGCGTCGAGGAGGCAATCGAAATGTGGAGCTTCTG. Left deleted probe: CCAAAGTGTTGAAAAACGGAAAATTCAGGATTTCGACGAGCGAATTGAGG. Right deleted probe: CAATTATGCAAATCTCGTCGATATTATACAAAATGATATAGATTTCGCTG. The allele gk3035 was identified by CGH but not confirmed by PCR. Left flanking probe: TGTTTCAGTATTGCCGTCTTATTATGTATAGATTTGCTATTCCATTTCTA. Right flanking probe: CATTTTCGAGTTCAATTTTCTGTGCAAACGCTGGAATGACAATATTCATG. Left deleted probe: TTTATCGTCCCATTAGCATTGTCACTTTTCAATGTTACTACAGTAGGATT. Right deleted probe: TTGTACGAAGGAGAGGAATATGCAAAGTTGAATGCTATTATTCATCTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y23H5A.5, C41D11.1, C41D11.6, F21H7.9. The allele gk1227 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AATCACTTTCGGTGCAGCTT. External right primer: GTATGCCCCACAGTTTTGCT. Internal left primer: AGTATCGCGGCATTGTTAGC. Internal right primer: TGCTCAAGCTTGGAGAGACA. Internal WT amplicon: 2419 bp. Deletion size: 367 bp. Deletion left flank: GCTACCACGGAACCTGAATTAGAAATTTCT. Deletion right flank: TATAAATCGTTTAAAAGAGTGACCACTTGC. Insertion Sequence: C. The allele gk3037 was identified by CGH but not confirmed by PCR. Left flanking probe: TCAATTTTGCCCGATCATATGAAGTTTGCAGTTTGCAACCTGTAGTTTGT. Right flanking probe: GAGAACTTGGAGGTGTTCTGTGACACCTGGGGGCAGGCGGTGAGTTATTG. Left deleted probe: AATGTTAGAATCAGCGTGGTCCAGCCTCGTTAGGTAGTCTCTCCGCCGCC. Right deleted probe: GTGCACCCATCTTCGAGGATAGCCAGGGAGAACTTGGAGGTGTTCTGTGA. The allele gk3038 was identified by CGH but not confirmed by PCR. Left flanking probe: AGATGAAGAAATGGGTAGGCTTTCCTTGCTCCCATGATTCCGAAGTTGAT. Right flanking probe: TTTTTAGGCGTTGTCGAGGCCGTAGCCGCCAAAAACGTTAGGCCGCGCAT. Left deleted probe: GATGACTTGTGGACGAAGATCCCATGACTTACTTTGAGCTGCAGTTTCTC. Right deleted probe: GTAAAATCAAATACGCGGAAGTATGTATACCCTTGCCTACTCTAGAATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E5A.5, T08B1.6. The allele gk1159 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TGAAGACGTTGAAGCAGGTG. External right primer: TGTTGACGATGACGGTGTTT. Internal left primer: GTGTTGTTGAAGCAGCTGGA. Internal right primer: GTGGAGACGAAGATCCCAAA. Internal WT amplicon: 2024 bp. Deletion size: 775 bp. Deletion left flank: GGGCTAAAAACGCAAAAACTGCAATTTCTA. Deletion right flank: AAAACAAACAATTTTTCAATATAATTTAAC. The allele gk3030 was identified by CGH but not confirmed by PCR. Left flanking probe: CAAAAGAATCAATCCACTAACAAATTGATTGGAATCGCTGGAATTCACTC. Right flanking probe: GCGGGTTTGACCTGACTACAGTACCACTTTATCATCAATCGAAATTGGAG. Left deleted probe: GGAATCGCTGGAATTCACTCGAGAAAATATATGCACACGATGCATGGAAT. Right deleted probe: GCGGGTTTGACCTGACTACAGTACCACTTTATCATCAATCGAAATTGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26A1.4, M04C7.4. The allele gk1160 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 126 bp. Deletion left flank: TCACGGATCGGACTCTTTACCGTGCAATGG. Deletion right flank: TTTTTTAAATTGAAAATGCGAGCATCTAGG. The allele gk3034 was identified by CGH but not confirmed by PCR. Left flanking probe: GTACGGTAAGTTGGCCGAGTTGCATTATTCGTCTCGTTCAAGAGGATAAC. Right flanking probe: CAGGCACGCAGGCGCATCTGCACGTACCATGGCTACTTTAGCTGATGAAC. Left deleted probe: GATTTTATCAGCATACGGGCTCGTAAAAGAGAAGAGGAGACGAGGTTACG. Right deleted probe: CTGTGGCTGCTGTTCCAAATGCCAATCTGGAAATGGGAATTTCGGTAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC374.2, F15A4.8, T16G1.9. The allele gk1152 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 842 bp. Deletion left flank: TCAATGTTCTACTTTTTAACGCATTTACGT. Deletion right flank: GGTTTAGAAGATAACTTTAAATGTTTAAAC. The allele gk3032 was identified by CGH but not confirmed by PCR. Left flanking probe: TCCATAATTCTAGCGACGTTGAAGTTTATCTGTGGTTCATGGCCGGAGTA. Right flanking probe: GTCGTAATTCAGAAAGAAACTCTGAAACCATGTGCTGGTTGGATTCCAGC. Left deleted probe: ATCTGTGGTTCATGGCCGGAGTACAGTGGAAGAGGACCAATTAGTGAACT. Right deleted probe: TTGAGATTAGATACTGGGTTTGCAGAGCCTGTCGTAATTCAGAAAGAAAC. The allele gk3033 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAAGCAGGAGGTCACTTGTTTTGCTTTCCGATAATAATTGAATATCTAG. Right flanking probe: GGATAACCAAACATGTTGAAATTGGCCACGGACGCGTAGCATTCTAAAGA. Left deleted probe: GAAACAAAAGGCCAGGCGATAGAAAATAAGGCAGTAAACGTCAATTAATA. Right deleted probe: AATAATTGTTTACCCATTTCTTGTAAATCATGAGGCAATAGTGCTCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25A8.5, F45H7.2. The allele gk1224 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: GTGGAGCGTTCGGTACATTT. External right primer: TCACACCCCTGACAGGTACA. Internal left primer: AACGGAACCGTTGAGAATTG. Internal right primer: GCCGCCTCACAAGTTAGTTT. Internal WT amplicon: 2303 bp. Deletion size: 1432 bp. Deletion left flank: TTTCCAACGAAAATGTGACTTTTTCAGGAA. Deletion right flank: ATCTACCCATCTTGAGATCAAAACTTTCGA. Insertion Sequence: CAATTTTATTTTAAAAAATGCTCTGTGCCGCTTTTGTCGATACAACTTCTGAAATTTTC AAAACCACCGCGGTGCCTCCCAGTAGGACTTCAAAAATTG. The allele gk3062 was identified by CGH but not confirmed by PCR. Left flanking probe: GAAAAAGATGGATCTAAGATCCACTAATAAGTGAGTACACATACAGTGTG. Right flanking probe: GAAATTTGATTCCGGACCGTATGTACGATGATCTCGATGACCTACCTCTG. Left deleted probe: ATCTACTGTTTGCAGACGACCAAAAGAAACACGTGGCAGACCTGCTCCAA. Right deleted probe: GTTATTTTGTTTTTATCAGCTTCAAGGCGGTCTACATCTGCCTTGCGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC374.2, B0564.10, Y67A10A.104, T13F3.1. The allele gk1222 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 1618 bp. Deletion left flank: CATTTTTCAGTGCTGTTTCTTCCACATTAT. Deletion right flank: TCAGATCTTCTAACTCGCGTTTCTAACTTT. The allele gk3024 was identified by CGH but not confirmed by PCR. Left flanking probe: TTTCGACTGCTGCAAATTTGGCACCTCTACCAACGTGAGTTTTACGGATA. Right flanking probe: TTGTTTGAGCTGCCGGGATGCCAGGAGGAGGGAACAGACAGAGCAGGTAT. Left deleted probe: AAAAATTATAATTTACATTTTTCCAGAGCCCAAGCTGCATTCTCCACATC. Right deleted probe: TTCCTCATCGCTCGGCCAACCTTATCAACCCTGTCAGTACAGTGGACCAC. The allele gk3025 was identified by CGH but not confirmed by PCR. Left flanking probe: GGGATTCGTGGTCGAGATTGCCAGTCCAAGGCTTGGTCGGTTTCAGGTTG. Right flanking probe: GGTTAATGTGAAACTTGATTTAACTGTTCCACGAGTATGCTTTAACAATA. Left deleted probe: TGATTCGCAAAAACAACGAATTGTATAGAACTCACACTTTAAGACATCTA. Right deleted probe: AAATTGCTTACTGACTTTGATGCAAAACAGGTGATTTTTCGGGTTCTAAA. The allele gk3061 was identified by CGH but not confirmed by PCR. Left flanking probe: CAGATTATCTCACTTACTGTTATTGCATATTGTGGGACATGTTGCTACTA. Right flanking probe: GGATCACATACTAAACTTAATTCTTTTCAGACCGCAATACCAATGCTTCT. Left deleted probe: ATATTGTGGGACATGTTGCTACTATAAAATACAACAGCAAATGAGGGTTG. Right deleted probe: ACCTACATCGTCAACTGTTCTACGCTTTGGCAATCCAGGTTTGACGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46E10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3066 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCGATCAGCAGTTGACCA. External right primer: CAAAGTTGGCAATGGTTGTG. Internal left primer: CAACACAGTTTGCCAGTGCT. Internal right primer: GAGACGACTTGCTGGAGACC. Internal WT amplicon: 2067 bp. Deletion size: 880 bp. Deletion left flank: TTTATTTTAAAAAATATTTAAAAAGTTTTA. Deletion right flank: TATGACTGACATGCAAGTATGCTATGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3018) in C40D2.4, detectable by PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 847 bp. Deletion left flank: GGAAATTCATTTTATCGATTTTTCATATAA. Deletion right flank: CTCATAATAATTTAATATATGTGACGTTGA. Validation: gk3018 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09B4.7, F59A2.1. The allele gk1215 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CGTCTTTCACTCGCCTTTTC. External right primer: CAAAATGGAGAGTACCCGGA. Internal left primer: TATTCTGTATGACGCCGCAC. Internal right primer: CCGGCCTGATCTGAGAGTAA. Internal WT amplicon: 2551 bp. Deletion size: 661 bp. Deletion left flank: AAAGAAATAAAGCTCCAGATGATATCACGT. Deletion right flank: GGAAAGCAACTTATCATTTCCCATACCAAC. The allele gk3059 was identified by CGH but not confirmed by PCR. Left flanking probe: TTCCATTCTCAATATTTGAAGGGAGTGTCTCCTCCGAAATGGTCACCTGG. Right flanking probe: CAGAACATGGTTTGCTCTCCTTCTTCTCCAGTTTTCACCTCGACAAGATC. Left deleted probe: GTCTCCTCCGAAATGGTCACCTGGTCTCGTCGCATAACAACTCTCCACGA. Right deleted probe: CGTTGGCATAAATGTAGAGTTTTGAACGATTGCAGAACATGGTTTGCTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45H11.6, F09A5.2. The allele gk1216 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 646 bp. Deletion left flank: GATGAAGAATGAGAAAGGAAATATTTGAAG. Deletion right flank: AATAATGTTGTCTGGTACAGGTATCAAATC. The allele gk3060 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right flanking probe: TGGTGAGTGACCTTTCCATAAACCGAATTACCTCGGAAAATGTTTTTAGA. Left deleted probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right deleted probe: GAGAAGACATAAAGATTATGTGCTGATGGTGAGTGACCTTTCCATAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52C12.2, F52C12.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3019 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTCTATTTTTCCCCCGAAG. External right primer: TTGCATCTTGCGGTAGACAG. Internal left primer: TTCGGAGCTTCGTTGTTTCT. Internal right primer: ATCCCGTCTCAATTGTCGTC. Internal WT amplicon: 3351 bp. Deletion size: 2297 bp. Deletion left flank: AATTTTAAAATTTTAATTCCTTGTGGCAAA. Deletion right flank: CGACTCGGAAGGCGAAATGGATTTTGAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R151.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3067 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACAAAGATCACTCAATCCATCA. External right primer: AACATCGTCGTTCAGAATCTCAT. Internal left primer: TTTCTCTTGGGACCTTTGGTAA. Internal right primer: AAAATGAGCAGAATCGAATGGT. Internal WT amplicon: 1962 bp. Deletion size: 1090 bp. Deletion left flank: AGTTTTGGCAACTTATCAGTTAGAATAAAA. Deletion right flank: CCTCAAAATTTCAGATTGGTTGAAGCCGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3015) in R173.4, detectable by PCR using the following primers. External left primer: AAAAGGATCCGAAAGGAGGA. External right primer: GCGTGTTACTGTACGCGAAA. Internal left primer: TTGCTCCTCCTTCCACACTT. Internal right primer: GGAAAGGGGGAAGTTGACTC. Internal WT amplicon: 1628 bp. Deletion size: 665 bp. Deletion left flank: ATCATTGAAATTCTTCACGAGAAACAATTG. Deletion right flank: CAACCAGTGCCTTCCGACTTCCATTCCAGG. Validation: gk3015 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3017) in F12F6.5, detectable by PCR using the following primers. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 1203 bp. Deletion left flank: GTACCAAAAAAAGAGAGAATGCGTCTTCCT. Deletion right flank: GATGATAGATTCTACATATGAATCAGCTGA. Validation: gk3017 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11G11.2. External left primer: CGGACATTTTCCGTTCAACT. External right primer: GCATTCTGGTCCGTTTTGAT. Internal left primer: GGTGCCCAGTTGTAGAGCAT. Internal right primer: AGAAAGGAAAGACGCAGGTG. Internal WT amplicon: 1957 bp. Deletion size: 694 bp. Deletion left flank: TTTGGCACATGTGGGGGAGGATGGACAAGC. Deletion right flank: AAACTATCTACAGTAGTTCTACAGTATTCC. Validation: gk3046 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3027) in C03C10.2, detectable by PCR using the following primers. External left primer: ACTACCGTGCTCTTGGCACT. External right primer: TCAACCTCACCCCATTTCTC. Internal left primer: GCATGTGTCTACCATCCACG. Internal right primer: GCAGTGATTTCGGGCTGTAT. Internal WT amplicon: 2385 bp. Deletion size: 826 bp. Deletion left flank: ATGCATTGAAAGATATTCATGATATGGGAT. Deletion right flank: TCAAAACCGAATCCGGTGTATGCATTCCAT. Validation: gk3027 passed by CGH. Other deletions (gk3247, gkDf34) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0228.8. External left primer: CATACATAGAGTGCCCAAGAGATG. External right primer: ATCGGTTTTTCAAATTTTGTCATT. Internal left primer: ATTTGTTTGCTTCGGAACAGAT. Internal right primer: TTTTTGGAGCTGTTTTGGAAAT. Internal WT amplicon: 1734 bp. Deletion size: 306 bp. Deletion left flank: CAACTTCTGCATAATAATTGCTCAAGAATG. Deletion right flank: CAATACTTATTGATAAGAAAAAGACAAATA. Validation: gk3093 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R04B5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3064 homozygotes (mid- to late-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 894 bp. Deletion left flank: AATGGGACACCGAGTTCTTGTTCTCGGAGC. Deletion right flank: TATTAAAATGCCGAGAGGAAACATGATGTC. Insertion Sequence: AGGACCAATTGGAGTCTTGAATCTTCTTACTGCTAAAGCGATAGGTGCATCAAAAGTAG TAATCACTGATTTGAACGACGAGAGACTTGCTCTTGCACGCCTATTAGNAGCTGATGCT ACAATCAATGTTATGTAATAAAGAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G10.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3077 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGAATGCAAAACCTGAGAACAA. External right primer: TACAGCTGGATTTTCAACTGGAT. Internal left primer: ATACACCCGCTTTCCACAAG. Internal right primer: CCTCCAGCTTTCGATTTACG. Internal WT amplicon: 2029 bp. Deletion size: 368 bp. Deletion left flank: TTCGGTTACTCTTTGTTTTATATTTATTTT. Deletion right flank: TATTCAGTCTATGAAATACGATAAAGAAGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y50D7A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3089 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTATCCGAATTTTCTGCGG. External right primer: ATTTTCAACGGAATTCGACG. Internal left primer: GAAAATTTTGCATTTTCAAGGC. Internal right primer: TCCGCGATTTTTATAGCATTTT. Internal WT amplicon: 940 bp. Deletion size: 647 bp. Deletion left flank: TTTTGTCAAGCCTCAAATCCCACAATTTTG. Deletion right flank: ATAAATGAGCCAAAATTCGTCAAATTCTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3099) in Y41D4B, detectable by PCR using the following primers. External left primer: GAAACGTTGGAAAAACGGAA. External right primer: CTTTGTTCGCTGCGTAATGA. Internal left primer: CAATTTCCATACCCTCGCTC. Internal right primer: CGCACACAAGCCTTAACTCA. Internal WT amplicon: 1594 bp. Deletion size: 191 bp. Deletion left flank: GGAAACTGTGTGTTTCTGAAAATAGAGGTT. Deletion right flank: GACCACCCCAAGTGTCCTAACTCGGAGCCA. Insertion Sequence: AAAA. Validation: No CGH probes for gk3099. Other deletions (gk3204, gk3205) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y66A7A.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3098 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATATTGAAAACTAGGAACTTGGCG. External right primer: CCTACCAGAATCAGTATGCACATC. Internal left primer: CTGAATTTGTTCCATTGTTAGAAAGA. Internal right primer: CTTAAAGTCAAAAACAAACGTTCAAA. Internal WT amplicon: 1543 bp. Deletion size: 474 bp. Deletion left flank: AGGATTAGGCATAGGTTTAGGCTTAGGGTT. Deletion right flank: TTGTAGTTGGATTCTGGATTGAGATGCTCG. Insertion Sequence: GGGCTTAGGATAAAGCTTTGGCTCACGCTTAGGTTTAGGATTAGGTATAGGTTTAGGCT TAGGGTTAGGCTTAGGGTTAGGCTTAGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3094) in ZC376.7, detectable by PCR using the following primers. External left primer: TTTCAGTCGTTTCAGGACCC. External right primer: TCATCGAGTTGATCTCACGC. Internal left primer: ATAGAAACCGCCTCCTTTCG. Internal right primer: TTCTCGGCTCGTTTCTTCTC. Internal WT amplicon: 2877 bp. Deletion size: 881 bp. Deletion left flank: ACTGGACCTCGACTCATGGCACACTAAGCC. Deletion right flank: ATCAAGTTATCTTCACGGAAAAATGTTCGA. Validation: gk3094 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G10A.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3088 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAATTGTTCGGCGAATTTT. External right primer: AAACATTTTCAACCCTGCAAGT. Internal left primer: ATACGTCACCCGAGCAATTC. Internal right primer: CAACCAGAATGCAGAGCAAA. Internal WT amplicon: 1226 bp. Deletion size: 763 bp. Deletion left flank: CCAGTATAGATTGAATAACTTTAAAAATTT. Deletion right flank: AAAATGCTCCACGTACGCATTCTCATGATT. Insertion Sequence: AACTATAGTTATTTAAATTCTTACTGTAGTTTTCGCTAAGTGATATCGCGCGTCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A8.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3090 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCGTATTATGGCAGCTCAC. External right primer: CGTTCGAGCCCACATTTTAT. Internal left primer: CGATTTTGATTTTTACAATTGCTG. Internal right primer: ATCATTTTGAAAGGGAGACTCAAC. Internal WT amplicon: 1355 bp. Deletion size: 373 bp. Deletion left flank: AGTTTCGATTAAATTTTTTTAAATTTAAAT. Deletion right flank: CTTCCGAATCGACGACCGCCTGGACTCGGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01A2.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TAAATATAATACCGTGCGTGCG. External right primer: TCAAAGTCATGTTTCCGTATCG. Internal left primer: GGCTCAGGGTAAATAGACATGG. Internal right primer: TTTAAATGGGTTTGAATCTGGG. Internal WT amplicon: 1458 bp. Deletion size: 510 bp. Deletion left flank: ATTGCAAAAGTGGGCGGGGCGTCGTTTCGT. Deletion right flank: ATCAACTCGATTTTGAGCAAAACTATCTCG. Insertion Sequence: TAGTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30B5.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3082 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGGTGTGTGCATAAGGA. External right primer: TTGATTGAATTGGCGATGAA. Internal left primer: GAGAGCTTCGGAAGACATGG. Internal right primer: TCCAGGTTCCCTGAAACAAG. Internal WT amplicon: 1567 bp. Deletion size: 390 bp. Deletion left flank: AAAATTTGAAAAAGGCTTTATATTAATGTT. Deletion right flank: TCGGATTCATGTTTTACTGCAAAATGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G2.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk3083 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCATTCGTGTTTCGATGA. External right primer: AGTTATCCCCACCGCTTTTT. Internal left primer: AACCGGAAAAATTCCAAACC. Internal right primer: CTTCTTCGCCGTTTCACTTC. Internal WT amplicon: 2013 bp. Deletion size: 836 bp. Deletion left flank: CCGTTTTGTGGACGTCCAACTGGATTTCCA. Deletion right flank: TTGGCTTCCAAAGCTTCAAGAGATTGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable, carrying deletions in T19B4.3, dhhc-11, twk-4 and F26D11.2, plus a large multi-gene deletion on LG V. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Apparent homozygous lethal deletion chromosome (gk3069 in F56C11.1) balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk3069 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTGCAAATGAAGGAGCATC. External right primer: CTTCACACCGTTGGACATTG. Internal left primer: TCCACAACTGAACACTCCGA. Internal right primer: TTCAGGAAGCATTCTTTGGG. Internal WT amplicon: 1399 bp. Deletion size: 443 bp. Deletion left flank: CTGAACACTCCGATTTTGGATTGCTGCAAA. Deletion right flank: AGGAAATATACTTTACGGCAACGAACTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R53.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3079 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGTCCGTGAACGTTCTTGTT. External right primer: CAAAGAAAGCCAAGGTCGAG. Internal left primer: AAAATGTGTGCAGTTTTCAACG. Internal right primer: AACAACGACATCGTGTTCACTC. Internal WT amplicon: 1340 bp. Deletion size: 565 bp. Deletion left flank: TTATATCCTATTTTCTGCTTTAAATTTGAG. Deletion right flank: AATTTGAAACGTCAGATGGAACTCAAGTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807